Informație

Cum se leagă glicoforina A și straphylococcal de Escherichia coli și ce înseamnă purificarea ușoară în acest context?


Revizuiesc lucrarea „Glicoforina o dimerizare este determinată de interacțiuni specifice între alfa-helice transmembrane”. Există o afirmație în abstract pe care nu o înțeleg:

"Domeniul alfa-elicoidal transmembranar de interes este fuzionat la capătul C al nucleazei stafilococice. Himera rezultată poate fi exprimată la niveluri ridicate în Escherichia coli și este ușor purificată."

După cum am înțeles, acest lucru descrie că o alfa-helix din glicoforină A este fuzionată cu nucleaza strilococică? Atunci, cum intră Escherichia coli în discuție și ce se înțelege prin purificarea ușoară?


Practic, au conceput un vector care, atunci când este transfectat la E. coli, produce transcripții ale-și, astfel, proteine ​​la- o genă de fuziune care produce aceste helici transmembranare α conjugate cu nucleaza stafilococică. Cu alte cuvinte, E. coli sunt doar fabrici de producere a proteinelor:

Exprimarea, extragerea și purificarea SN / GpA - Pentru niveluri ridicate de producție SN / GpA, pT7SN / GpA a fost transformat în E. coli MGT7 (furnizat cu amabilitate de D. LeMaster), conținând plasmida pLYS-S.

Și raționamentul a fost propus în discuție,

Raportăm aici utilizarea unei proteine ​​himerice pentru a arăta că prezența doar a domeniului transmembranar al GpA, fuzionat cu o proteină solubilă normal monomerică, este suficientă pentru a media dimerizarea acestei proteine ​​de membrană artificială - în SDS

Ceea ce înseamnă prin purificare ușoară este că proteina poate fi extrasă relativ ușor, iar în metoda experimentală explică câteva metode banale de purificare:

Purificarea într-o etapă a cantităților de miligrame de SN / GpA din extract ar putea fi realizată prin HPLC în fază inversă utilizând un gradient acetonitril / alcool izopropilic / apă pe o coloană semipreparativă Vydac C4. Alternativ, purificarea cantităților mai mari a fost realizată folosind două runde de cromatografie cu schimb de cationi ...

… Chimera SN / GpA131, dar nu forme trunchiate, ar putea altera NaCl, 50 mM Tris-HC1, 5 mM EDTA, 1 mM PMSF, 0,025% NaNa, ar putea fi extrasă nativ prin sonicarea peletei după liza celulară în 1 M pH 7,9, care nu conține detergent. Această extracție a avut o eficiență similară cu cea de la Lubrol și a fost utilizată la prepararea materialului pentru generarea peptidei transmembranare prin tratamentul cu tripsină.


Descărcați și tipăriți acest articol pentru utilizare personală, științifică și educativă.

Cumpărați un singur număr de Ştiinţă pentru doar 15 USD.

Știință Medicină Translațională

Vol. 6, Ediția 247
30 iulie 2014

Instrumente pentru articole

Vă rugăm să vă conectați pentru a adăuga o alertă pentru acest articol.

De Faith H. Osier, Margaret J. Mackinnon, Cécile Crosnier, Gregory Fegan, Gathoni Kamuyu, Madushi Wanaguru, Edna Ogada, Brian McDade, Julian C. Rayner, Gavin J. Wright, Kevin Marsh

Știință Medicină Translațională 30 iulie 2014: 247ra102

Proteine ​​necaracterizate din stadiul merozoit al Plasmodium falciparum furnizează noi antigeni pentru dezvoltarea vaccinului în stadiul sanguin al malariei.


Introducere

Investigațiile asupra mecanismelor care controlează expresia genelor la mamifere s-au concentrat în mare măsură pe transcriere și, într-o măsură mai mică, pe evenimente post-transcripționale legate de soarta mARN-urilor specifice și de localizarea lor celulară. Cu toate acestea, creșterea dovezilor biochimice indică un alt nivel de reglare în timpul diferențierii somatice și a celulelor germinale, și anume controlul translațional. Reglarea translațională poate fi realizată fie prin modificarea concentrațiilor sau activităților factorilor generali de translație (Mathews și colab., 2000) sau într-un mod specific ARNm, dependent de interacțiunea lui trans-factori de acțiune cu cis-secvențe de acțiune prezente pe ARNm (Rouault și Harford, 2000).

Fosforilarea subunității α a factorului de inițiere translațional 2 (eIF2α) a fost recunoscută ca un mecanism cheie al inhibării globale a inițierii translaționale. eIF2 este un factor de inițiere translațional general compus din trei subunități: α, β și γ. eIF2 formează două tipuri de complexe binare: eIF2⋅GTP activ și eIF2⋅GDP inactiv. eIF2⋅GTP leagă met-ARNteu pentru a forma un complex ternar care este necesar pentru legarea la subunitatea 40S a ribozomului și ARNm. Ulterior, la aderarea la subunitatea 60S, GTP de la eIF2⋅GTP este hidrolizat la PIB. Pentru a recicla la forma sa activă și a lega un alt Met-tARNeu, eIF2⋅GDP trebuie convertit în eIF2⋅GTP printr-o reacție de schimb de guanilat catalizată de eIF2B. eIF2 are o afinitate de 400 de ori mai mare pentru PIB decât pentru GTP. Schimbul de PIB strâns legat de GTP necesită eIF2B, care se află în concentrații limitative și este prezent la 15-25% din cantitatea de eIF2 (Trachsel, 1996).

Reciclarea eIF2 este inhibată de fosforilarea subunității sale α. Fosforilarea subunității α a eIF2 la Ser51 este realizată de o familie de kinaze eIF2α. EIF2 fosforilat (αP) ⋅GDP se leagă mult mai strâns de sub-complexul de reglementare al eIF2B decât eIF2⋅GDP și previne activitatea de schimb PIB-GTP a eIF2B (Krishnamoorthy și colab., 2001). Astfel, odată ce cantitatea de eIF2 fosforilată depășește cantitatea de eIF2B, sinteza proteinelor este oprită.

Au fost identificate patru eIF2α kinaze la mamifere: kinaza eIF2α dependentă de ARN dublu catenar (PKR), ortologul de mamifer al protein kinazei GCN2 de drojdie, kinaza rezidentă a reticulului endoplasmatic (ER) (PERK) și kinaza eIF2α reglată de hem. HRI). Aceste kinase eIF2α au o omologie extinsă în domeniile lor catalitice ale kinazei (Meurs și colab., 1990 Chen și colab., 1991 Ramirez și colab., 1991 Berlanga și colab., 1998 Shi și colab., 1998 Harding și colab., 1999). Deși toate inhibă sinteza proteinelor prin fosforilarea eIF2α, se prezice că un răspuns fiziologic diferențial poate fi produs ca o consecință a distribuției lor tisulare și a semnalelor la care răspund. PKR este indus de interferon și reglat de dsRNA prin două domenii N-terminale de legare a dsRNA (Kaufman, 2000). GCN2 este extrem de exprimat în ficat și creier (Berlanga și colab., 1999 Sood și colab., 2000) și este activat în condiții de înfometare a aminoacizilor prin domeniul C-terminal, care conține o secvență His-tRNA sintază (Hinnebusch, 1996). PERK este foarte exprimat în țesuturile secretoare, în special în pancreas, și este activat de stresul ER. PERK conține un domeniu luminal care este similar cu domeniul senzor al kinazei de stres ER Irel (Ron, 2000). HRI este exprimat predominant în celulele eritroide și este reglat de hem, grupul protetic al hemoglobinei, prin cele două domenii de legare a hemului situate în capătul N-terminal și prin inserția kinazei (Chen, 2000).

HRI a fost studiat pe larg biochimic. Este bine documentat că sinteza proteinelor în reticulocitele intacte și lizatele lor depinde de disponibilitatea hemului. În deficiența hemului, inhibarea sintezei proteinelor se corelează cu activarea HRI (Clemens, 1996 Chen, 2000). Exprimarea HRI în celulele Sf9 ale insectelor determină inhibarea globală a sintezei proteinelor. În plus, HRI exprimat cu baculovirus este o hemoproteină a cărei activitate este reglată de concentrațiile micromolare de hemină, atât in vitro și in vivo (Chefalo și colab., 1994, 1998). HRI conține două site-uri distincte de legare a hemului. Hemul legat de domeniul N-terminal este stabil și co-purifică cu HRI până la omogenitate. În schimb, hemul se leagă de domeniul de inserție a kinazei în mod reversibil și inhibă activitatea kinazei HRI la legare, reglând astfel activitatea HRI în funcție de concentrațiile hemice intracelulare (Chefalo și colab., 1998 Rafie-Kolpin și colab., 2000). Proteina HRI, activitatea și ARNm sunt detectate predominant în precursorii celulelor roșii din sânge (RBC), iar nivelurile de ARNm HRI cresc în timpul diferențierii eritroide a celulelor eritroleucemice de șoarece (MEL) (Crosby și colab., 1994). Cantități mici de ARNm HRI se găsesc și în țesuturile non-eritroide, dar nu au fost raportate dovezi ale expresiei proteinelor HRI (Mellor și colab., 1994 Berlanga și colab., 1998 ).

Pentru a elucida rolul fiziologic al HRI, în contextul unui animal întreg, am perturbat gena HRI din celulele stem embrionare de șoarece (ES). Șoarecii HRI - / - par a fi normali, sunt fertili și nu prezintă nicio anomalie majoră a parametrilor hematologici. Cu toate acestea, în deficit de fier, răspunsul adaptativ al șoarecilor de tip sălbatic (wt), caracterizat prin hipocromie și microcitoză RBC, a fost dramatic modificat. La șoareci HRI - / -, dimensiunea RBC a rămas normală cu anemie hipercromică, mai degrabă decât anemie hipocromă. Globine lipsite de hem agregate ca incluziuni în RBC și precursorii săi, rezultând anemie cu hiperplazie eritroidă compensatorie și apoptoză accelerată a precursorilor eritroizi în măduva osoasă și splină. Împreună, aceste rezultate stabilesc rolul fiziologic al HRI în echilibrarea sintezei α- și β-globinelor cu disponibilitatea hemului în precursorii RBC. Mai mult, această reglare translațională a HRI în deficitul de fier este necesară pentru supraviețuirea precursorilor eritroizi.


Gary Schoolnik

Medicină - Boli infecțioase

Focus clinic

Numiri academice

Educatie profesionala

A lua legatura

Informații suplimentare

Cercetări curente și interese științifice

Analiza structură-funcție a proteinelor și a toxinelor de adeziune bacteriană Proiectarea și sinteza imunobiologiei antigenelor sintetice a papilomavirusurilor umane

Cursuri 2020-21

    Studii independente (14)

      EARTHSYS 297 (Aut, Win, Spr)
      ENVRES 398 (Aut, Win, Spr, Sum)
      MED 299 (Aut, Win, Spr, Sum)
      MI 299 (Win, Spr)
      EARTHSYS 250 (Aut, Win, Spr)
      ENVRES 399 (Aut, Win, Spr, Sum)
      MED 280 (Aut, Win, Spr, Sum)
      MED 399 (Aut, Win, Spr, Sum)
      MI 399 (Win, Spr)
      EARTHSYS 199 (Aut)
      MED 370 (Aut, Win, Spr, Sum)
      MI 370 (Win, Spr)
      MED 199 (Aut, Win, Spr, Sum)
      MI 199 (Win, Spr)

    Toate publicațiile

    • Costul competitiv al rezistenței la antibiotice în Mycobacterium tuberculosis ŞTIINŢĂ Gagneux, S., Long, C. D., Small, P. M., Van, T., Schoolnik, G. K., Bohannan, B. J. 2006 312 (5782): 1944-1946

    Abstract

    Modelele matematice prezic că viitorul epidemiei de tuberculoză multirezistentă va depinde de costul de fitness al rezistenței la medicamente. Arătăm că la mutanții de laborator de Mycobacterium tuberculosis, rezistența la rifampicină este universal asociată cu un cost competitiv de fitness și că acest cost este determinat de mutația de rezistență specifică și de fundalul genetic al tulpinilor. În schimb, demonstrăm că tratamentul prelungit al pacientului poate duce la tulpini multirezistente fără defecte de fitness și că tulpinile cu mutații de rezistență scăzute sau fără costuri sunt, de asemenea, cele mai frecvente dintre izolatele clinice.

    Abstract

    Recent a devenit fezabil cuantificarea tuturor mARN-urilor codificate de genomii agenților patogeni bacterieni și a celulelor gazdă eucariote ale acestora și aplicarea acestei abordări pentru a studia interacțiunea Mycobacterium tuberculosis cu celula gazdă primară, macrofagul. Aceste studii au ajutat la identificarea circuitelor de reglementare care mediază adaptarea transcriptomului M. tuberculosis la mediile intraphagosomale și au stimulat ipotezele funcției acestor circuite în tuberculoza umană. Transcriptomul macrofagului reacționează la infecții cu inducerea unui program de expresie nespecific patogen, precum și inducerea semnăturilor de expresie specifice agentului patogen, ambele contribuind la activarea imunologică a celulei infectate. Modificările induse de M. tuberculoza în transcriptomul macrofagelor sunt mediate de căile de transducție a semnalului dependente de receptorul Toll și de receptorul Toll-like. Acest răspuns este modelat de molecule reactive de azot și oxigen produse de macrofage și este afectat de viabilitatea și virulența agentului patogen.

    Abstract

    Variația de fază între variantele de colonii netede și rugoase ale Vibrio cholerae se prezice a fi importantă pentru supraviețuirea agentului patogen în ecosistemele sale acvatice naturale. Varianta rugoză formează colonii ondulate, prezintă niveluri crescute de rezistență la stresuri osmotice, acide și oxidative și are o capacitate sporită de a forma biofilme. Multe dintre aceste fenotipuri sunt mediate parțial de producția crescută a unui exopolizaharid numit VPS. În acest studiu, am comparat profilurile totale de proteine ​​ale variantelor netede și rugose folosind electroforeza bidimensională pe gel și am identificat o proteină care este prezentă la un nivel mai ridicat în varianta rugose. O mutație a genei care codifică această proteină, care nu are omologi cunoscuți în bazele de date cu proteine, determină celulele să formeze biofilme care sunt mai fragile și sensibile la dodecil sulfatul de sodiu decât biofilmele de tip sălbatic. Rezultatele indică faptul că gena, denumită rbmA (rugozitate și modulator A al structurii biofilmului), este necesară pentru formarea coloniilor de rugoză și integritatea structurii biofilmului în V. cholerae. Transcrierea rbmA este reglementată pozitiv de regulatorul de răspuns VpsR, dar nu de VpsT.

    Abstract

    Vibrio cholerae, agentul etiologic al bolii diareice, poate ucide un adult infectat în 24 de ore. V.cholerae trăiește ca un microb autohton în estuare, râuri și ape de coastă. O mai bună înțelegere a căilor sale metabolice va ajuta la dezvoltarea unor tratamente mai eficiente și va oferi o înțelegere mai profundă a modului în care această bacterie persistă în habitatele acvatice naturale. Folosind secvența genomică V.cholerae completată și software-ul PathoLogic, am creat VchoCyc, o bază de date cale-genom care a prezis 171 căi metabolice probabile în bacterie. Raportăm aici dovezi experimentale care susțin căile prognozate prin calcul. Dovezile provin din studiile de exprimare a genelor microarray ale V.cholerae în scaunele a trei pacienți cu holeră [D. S. Merrell, SM Butler, F. Qadri, NA Dolganov, A. Alam, MB Cohen, SB Calderwood, GK Schoolnik și A. Camilli (2002) Nature, 417, 642-645.], Din studii de expresie genică în creștere minimă condiții și mediu bogat în LB și din teste clinice care identifică colerele V. Datele de expresie oferă dovezi care susțin 92 (53%) din cele 171 de căi. Testele clinice oferă dovezi care susțin șapte căi, cu șase căi susținute de ambele metode. VchoCyc oferă biologilor un instrument util pentru analiza informațiilor metabolice și genomice ale acestui organism, care ar putea duce la perspective potențiale asupra noilor agenți anti-bacterieni. VchoCyc este disponibil în colecția de baze de date BioCyc (http://BioCyc.org).

    Abstract

    Genomul Vibrio cholerae structurat pe mozaic indică importanța transferului orizontal de gene (HGT) în evoluția acestui agent patogen uman. Am arătat că V. cholerae poate dobândi material genetic nou prin transformare naturală în timpul creșterii pe chitină, un biopolimer care este abundent în habitate acvatice (de exemplu, din exoscheletele crustacee), unde trăiește ca un microb autohton. Competența de transformare necesită un complex de asamblare pilus de tip IV, o proteină supusă legării ADN-ului și trei cascade de reglare convergente, care sunt activate de chitină, creșterea densității celulare și limitarea nutrienților, o scădere a ratei de creștere sau stres.

    Abstract

    Opțiunile chimioterapeutice pentru tratarea tuberculozei sunt sever restricționate de rezistența intrinsecă a Mycobacterium tuberculosis la majoritatea antibioticelor aplicate clinic. O astfel de rezistență este asigurată parțial de permeabilitatea redusă a învelișului lor unic de celule. Aici descriem un sistem complementar care coordonează rezistența la medicamentele care au pătruns în anvelopă, permițând micobacteriilor să tolereze diverse clase de antibiotice care inhibă țintele citoplasmatice. Acest sistem depinde de whiB7, o genă pe care Mycobacterium patogen o împărtășește cu Streptomyces, un gen înrudit filogenetic cunoscut ca sursă de diverse antibiotice. În M. tuberculosis, whiB7 este indus de concentrațiile subinhibitorii de antibiotice (eritromicină, tetraciclină și streptomicină) și mutanții whiB7 nuli (Streptomyces și Mycobacterium) sunt hipersusceptibili la antibiotice in vitro. M. tuberculoza este, de asemenea, sensibilă la antibiotice într-un sistem model monocit. În plus față de antibiotice, whiB7 este indus de expunerea la acizi grași pe care speciile patogene de Mycobacterium le pot acumula intern sau se pot întâlni în gazdele eucariote în timpul infecției. Analizele de profilare a expresiei genelor demonstrează că transcrierea whiB7 determină rezistența la medicamente prin activarea expresiei unui regulon, inclusiv gene implicate în protecția ribozomală și efluxul de antibiotice. Componentele sistemului whiB7 pot servi drept ținte atractive pentru identificarea inhibitorilor care fac M. tuberculoză sau derivații multirezistenți mai sensibili la antibiotice.

    Abstract

    Variația de fază reversibilă dintre variantele de colonii rugoase și netede se prezice a fi importantă pentru supraviețuirea Vibrio cholerae în habitatele acvatice naturale. Studiile de profilare a expresiei microarray ale variantelor rugoase și netede ale aceleiași tulpini au condus la identificarea a 124 de gene reglementate diferențial. Alte experimente de profilare a expresiei au arătat cum aceste gene sunt reglate de factorii de transcripție VpsR și HapR, care, respectiv, reglează pozitiv și negativ producția de VPS (El Tor), o polizaharidă extracelulară asociată cu rugoză. Studiul mutanților rpoN și rpoS a demonstrat efectele acestor factori sigma alternativi asupra expresiei genei specifice variației de fază. Analiza bioinformatică a acestor date de expresie arată că „rugozitatea” și „netezimea” sunt determinate de o ierarhie complexă de regulatori pozitivi și negativi, care afectează, de asemenea, biofilmul, hidrofobia suprafeței și fenotipurile de motilitate ale organismului.

    Abstract

    Chitina, un polimer insolubil al GlcNAc, este o sursă abundentă de carbon, azot și energie pentru microorganismele marine. Profilarea expresiei microarray și studii mutaționale ale Vibrio cholerae care cresc pe o suprafață naturală a chitinei sau cu oligozaharidele solubile de chitină (GlcNAc) (2-6), GlcNAc sau dimerul glucozaminei (GlcN) 2 au identificat trei seturi de gene reglate diferențial. Arătăm că (i) ChiS, un senzor histidin kinază, reglează expresia setului de gene (GlcNAc) (2-6), incluzând un (GlcNAc) 2 operon catabolic, două chitinaze extracelulare, chitoporină și un tip care conține PilA Pilus IV, desemnat ChiRP (pilus reglementat de chitină) care conferă un avantaj semnificativ de creștere lui V.cholerae pe o suprafață de chitină (ii) GlcNAc determină expresia coordonată a genelor implicate în chemotaxia și aderența chitinei și cu transportul și asimilarea GlcNAc (iii) (GlcN) 2 induce genele necesare pentru transportul și catabolismul reziduurilor de chitină neacetilată și ( iv) pilusul MSHA exprimat constitutiv facilitează aderența la suprafața chitinei independent de chimia suprafeței. În mod colectiv, aceste rezultate oferă un portret global al unui program complex, cu mai multe etape V. cholerae pentru utilizarea eficientă a chitinei.

    Abstract

    Mecanismele înnăscute utilizate de Mycobacterium tuberculosis pentru a persista în perioadele de neproliferare sunt esențiale pentru înțelegerea fiziologiei bacililor în timpul bolii latente. Am folosit profilarea expresiei genomului întreg pentru a expune mecanismele adaptive inițiate de M. tuberculosis în două modele comune de neproliferare a M. tuberculosis. Primul dintre aceste modele a fost o curbă de creștere standard, în care modificările expresiei genelor au fost urmate de la creșterea exponențială prin tranziția la faza staționară. În cel de-al doilea model, am urmărit procesul de adaptare a M. tuberculosis în timpul tranziției de la creșterea aerobă la o stare de persistență anaerobă fără replicare. Cea mai izbitoare descoperire din aceste experimente a fost inducerea puternică a întregului regulon de „somnolență” DosR în aproximativ 20 de zile în timpul tranziției lungi către o stare anaerobă. Acest lucru este contrastat de răspunsul general dezactivat la faza staționară aerată, cu doar un răspuns parțial regulon de repaus. Din rezultatele prezentate aici concluzionăm că mediul limitat de respirație al modelului NRP sărăcit cu oxigen recreează cel puțin un factor fundamental pentru care genomul M. tuberculosis codifică un program adaptiv decisiv.

    Abstract

    Genomul Mycobacterium tuberculosis codifică aproximativ 170 de membri ai familiilor de gene unice micobacteriene PE și PPE. Dovezile sugerează că membrii acestor familii sunt proteine ​​asociate suprafeței peretelui celular care pot oferi un profil antigenic divers și pot afecta imunitatea. Pentru a determina dacă modelele de expresie ale genelor PE / PPE sunt în concordanță cu un rol în variabilitatea antigenică, am analizat datele microarray din 132 de condiții experimentale pentru exprimarea genelor PE / PPE. Modele de expresie a genomului întreg arată că genele PE / PPE sunt reglementate într-o manieră variabilă și în mare măsură independentă. Profilarea expresiei genice a 15 condiții unice a identificat reglarea diferențială a 128 din cele 169 de gene PE / PPE. Exprimarea genelor PE / PPE pare a fi controlată de o varietate de mecanisme independente. Aceste date indică faptul că expresia diferențială a genelor PE / PPE are potențialul de a oferi un profil antigenic dinamic în cursul schimbării microambientelor din cadrul gazdei.

    Abstract

    Pilii de formare a fasciculului de tip IV (BFP) de Escherichia coli enteropatogenă (EPEC) sunt necesari pentru virulență la voluntarii umani cu provocări orale și pentru aderența localizată și autoagregarea fenotipurilor in vitro. Biogeneza și funcția filamentului BFP sunt codificate de operonul bfp cu 14 gene. Complexul de asamblare BFP, conținând o proteină de fuziune BfpB-His6, a fost reticulat chimic in situ, iar complexul a fost apoi purificat din EPEC care exprimă BFP printr-o combinație de cromatografie de afinitate pe bază de anticorp pe nichel și BfpB. Caracterizarea complexului izolat prin imunoblotare utilizând anticorpi specifici proteinelor BFP a arătat că cel puțin 10 din cele 14 proteine ​​specificate de operonul bfp interacționează fizic pentru a forma un complex oligomeric. Proteinele localizate la membrana exterioară, membrana interioară și periplasmă se află în acest complex, demonstrând astfel că complexul se întinde pe spațiul periplasmatic. O combinație de imunofluorescență și studii de microscopie electronică cu transmisie cu secțiune subțire imuno-aurică au localizat acest complex la un pol al celulei.

    Abstract

    Macrofagele sunt activate dintr-o stare de repaus printr-o combinație de citokine și produse microbiene. Microbii sunt adesea detectați prin intermediul receptorilor de tip Toll care semnalizează prin MyD88. Am folosit microarrays pe scară largă în mai multe experimente replicate, urmate de analize statistice stricte pentru a compara expresia genelor în macrofage de tip sălbatic (WT) și MyD88 - / -. Am confirmat rezultatele cheie prin reacția în lanț a polimerazei cu transcripție inversă cantitativă, Western blot și testul imunosorbent legat de enzime. În mod surprinzător, multe gene, cum ar fi oxidul azotic sintază inductibil, IRG-1, IP-10, MIG, RANTES și interleukina 6 au fost induse de interferon (IFN) -gamma de la 5 la 100 de ori mai puțin extensiv în MyD88 - / - macrofage decât în ​​macrofage WT. Astfel, activarea pe scară largă pe scară largă a macrofagelor de către IFN-gamma necesită MyD88. Analiza mecanismului a arătat că MyD88 mediază un proces de autoamorsare prin care macrofagele în repaus produc un nivel scăzut de factor de necroză tumorală. Acest lucru și alți factori duc la activarea bazală a factorului nuclear kappaB, care se sinergizează cu IFN-gamma pentru inducerea genei. În schimb, infecția cu Mycobacterium tuberculosis (Mtb) virulentă activă a activat macrofagele în mare parte prin căi independente de MyD88, iar macrofagele nu au avut nevoie de MyD88 pentru a ucide Mtb in vitro. Astfel, MyD88 joacă un rol dinamic în macrofagele de repaus care susțin activarea dependentă de IFN-gamma, în timp ce macrofagele pot răspunde la un stimul microbian complex, bacilul tubercular, în principal pe alte căi.

    Abstract

    Modul predominant de transmitere a HIV la nivel mondial este prin contact heterosexual, mucoasa cervico-vaginală fiind principalul portal de intrare la femei. Mucoasa cervico-vaginală este colonizată în mod natural cu bacterii comensale, în primul rând lactobacili. Pentru a aborda nevoia urgentă de abordări controlate de femei pentru a bloca transmiterea heterosexuală a HIV, am proiectat izolate vaginale umane naturale de Lactobacillus jensenii pentru a secreta proteine ​​CD4 în două domenii (2D CD4). CD4 2D secretat a recunoscut un anticorp anti-CD4 dependent de conformație și a legat HIV tip 1 (HIV-1) gp120, sugerând că proteinele exprimate au adoptat o conformație nativă. Testele de infecție cu ciclu unic folosind HIV-1HxB2 purtând o genă reporter luciferază au demonstrat că CD4 2D derivat de Lactobacillus a inhibat intrarea HIV-1 în celulele țintă într-o manieră dependentă de doză. Important, coincubarea bacteriilor proiectate cu virusul raportor recombinant HIV-1HxB2 a dus la o scădere semnificativă a infectivității virusului celulelor HeLa care exprimă CD4-CXCR4-CCR5. Lactobacilii proiectați au cauzat, de asemenea, o scădere modestă, dar semnificativă statistic, a infectivității unui izolat primar, HIV-1JR-FL. Acesta reprezintă un prim pas important către dezvoltarea bacteriilor comensale proiectate în microflora vaginală pentru a inhiba transmiterea heterosexuală a HIV.

    Abstract

    Se știe puțin despre mediul biochimic din fagozomi care adăpostesc un agent infecțios. Pentru a evalua starea acestei organite am captat răspunsurile transcripționale ale Mycobacterium tuberculosis (MTB) în macrofage de la șoareci de tip sălbatic și oxid nitric (NO) sintază cu deficiență 2 înainte și după activare imunologică. Transcriptomul intraphagosomal a fost comparat cu transcriptomul MTB în cultura standard de bulion și în timpul creșterii în condiții diverse concepute pentru a simula caracteristicile mediului fagosomal. Genele exprimate diferențial ca o consecință a rezidenței intraphagosomale au inclus un răspuns interferon gamma și indus de NO care intensifică un program de eliminare a fierului, convertește microbul din respirația aerobă în respirația anaerobă și induce un regulon de repaus. Inducerea genelor implicate în activarea și beta-oxidarea acizilor grași a indicat faptul că acizii grași furnizează carbon și energie. Inducerea genelor dependente de sigmaE, dodecil sulfat de sodiu și gene implicate în modificarea acidului micolic a indicat deteriorarea și repararea învelișului celulei. Genele santinelă din transcriptomul intraphagosomal au fost induse în mod similar de MTB în plămânii șoarecilor. Transcriptomul microbian a servit astfel ca bioprobă a mediului fagosomal MTB, arătându-l nitrosativ, oxidativ, funcțional hipoxic, sărac în carbohidrați și capabil să perturbe învelișul celular al agentului patogen.

    Abstract

    Se estimează că două miliarde de persoane sunt infectate latent cu Mycobacterium tuberculosis. Factorii gazdă care inițiază și mențin această stare latentă și mecanismele prin care M. tuberculosis supraviețuiește în cadrul leziunilor latente sunt întrebări convingătoare, dar fără răspuns. Un astfel de factor gazdă poate fi oxidul nitric (NO), un produs al macrofagelor activate care prezintă proprietăți antimicobacteriene. Dovezile pentru semnificația posibilă a NO provin din modelele murine de tuberculoză care prezintă infecție progresivă la animale incapabile să producă izoforma inductibilă a NO sintazei și la animalele tratate cu un inhibitor NO sintază. Aici, arătăm că O2 și concentrațiile mici de NO, toxice, modulează competitiv expresia unui regulon de 48 de gene, care este exprimat in vivo și pregătește bacilii pentru supraviețuire în perioade lungi de repaus in vitro. S-a constatat că NO inhibă reversibil respirația și creșterea aerobă. O enzimă care conține hem, posibil oxidaza terminală în calea respiratorie, simte probabil și integrează nivelurile de NO și O2 și semnalizează regulonul. Aceste date conduc la un model care postulează că, în cadrul granuloamelor, inhibarea respirației prin producția de NO și limitarea O2 constrânge ratele de replicare a M. tuberculosis la persoanele cu tuberculoză latentă.

    Abstract

    Modificările morfologice distincte asociate cu ciclul complex de dezvoltare a agentului patogen bacterian intracelular obligatoriu Chlamydia trachomatis au fost istoric bine caracterizate prin microscopie. Un număr de gene reglate temporar au fost caracterizate anterior, sugerând că ciclul de dezvoltare clamidian este reglementat la nivel transcripțional. Această ipoteză a fost testată prin analiza microarray în care a fost analizat întregul genom al C. trachomatis, oferind o evaluare cuprinzătoare a reglării genei globale pe tot parcursul ciclului de dezvoltare chlamydial. Au fost identificate șapte grupuri genetice coezive temporal, cu 22% (189 gene) din genom exprimate diferențial în timpul ciclului de dezvoltare. Corelația acestor grupuri de gene cu evenimente morfologice distincte ale ciclului de dezvoltare chlamydial sugerează trei rețele globale de reglare a genelor specifice etapei.

    Abstract

    Spre deosebire de mulți agenți patogeni care sunt în mod evident dăunători gazdelor lor, Mycobacterium tuberculosis poate persista ani de zile în interiorul oamenilor într-o stare clinic latentă. Latența este adesea legată de condițiile hipoxice din cadrul gazdei. Printre genele M. tuberculozei induse de hipoxie este un factor de transcripție presupus, Rv3133c / DosR. Am efectuat întreruperea țintită a acestui locus urmată de analiza transcriptomului bacililor de tip sălbatic și mutanți. Aproape toate genele puternic reglementate de hipoxie necesită Rv3133c / DosR pentru inducerea lor. Analiza computerizată a identificat un motiv de consens, a cărui variantă este localizată în amonte de aproape toate genele M. tuberculosis induse rapid de hipoxie. Mai mult, Rv3133c / DosR se leagă de cele două copii ale acestui motiv în amonte de gena de răspuns hipoxic alfa-cristalină. Mutațiile din locurile de legare abolesc atât legarea Rv3133c / DosR, cât și inducerea hipoxică a unei gene raportoare din aval. De asemenea, experimentele de mutație cu Rv3133c / DosR au confirmat preziceri pe bază de secvență că capătul C-terminal este responsabil pentru legarea ADN-ului și că aspartatul din poziția 54 este esențial pentru funcționare. Împreună, aceste rezultate demonstrează că Rv3133c / DosR este un factor de transcripție al clasei de regulator de răspuns cu două componente și că este mediatorul principal al unui semnal hipoxic în M. tuberculosis.

    Abstract

    Transcriptomul bacterian este o entitate dinamică care reflectă răspunsul imediat, continuu și al întregului genom al organismului la mediul său. Profilarea expresiei microarray oferă un portret cuprinzător al lumii transcripționale, permițându-ne să privim organismul ca un „sistem” care este mai mult decât suma părților sale. Vigilența microorganismelor față de schimbările de mediu, caracterul rapid al răspunsului transcripțional, timpul de înjumătățire scurt al ARNm bacterian și natura scării genomului a investigației explică în mod colectiv puterea acestei metode. Aceleași caracteristici pun cele mai semnificative probleme experimentale de proiectare și execuție care, dacă nu sunt depășite, generează previzibil o imagine distorsionată a transcriptomului. Dimpotrivă, profilul de expresie al unui experiment de microarray conceput și realizat în mod corespunzător poate fi utilizat pentru testarea ipotezelor: dezvăluirea căilor metabolice și biosintetice care stau la baza adaptării organismului la schimbarea condițiilor de creștere identificarea genelor reglementate în mod coordonat. circuite și sisteme de transducție a semnalului care mediază răspunsul adaptativ și caracteristicile temporale ale programelor de dezvoltare. Studiul patogeniei bacteriene prin profilarea expresiei microarray-urilor prezintă provocări și oportunități speciale. Deși obstacolele tehnice sunt multe, obținerea profilurilor de expresie ale unui organism care crește în țesut va dezvălui probabil strategii de creștere și supraviețuire în microambientul gazdei. Identificarea acestor strategii de colonizare și a modelelor lor de exprimare înrudite implică un proces de „deconstrucție” care combină analiza bioinformatică și experimentarea in vitro a matricei de ADN.

    Abstract

    Proteina micobacteriană IdeR este un regulator dependent de metal din familia DtxR (represor de toxină difterică). În prezența fierului, acesta se leagă de o secvență ADN specifică în regiunile promotor ale genelor pe care le reglează, controlând astfel transcrierea acestora. În acest studiu, oferim dovezi că ideR este o genă esențială în Mycobacterium tuberculosis. ideR nu poate fi în mod normal perturbat în această micobacterie în absența unei a doua copii funcționale a genei. Cu toate acestea, a fost obținut un mutant ideR rar, în care efectele letale ale inactivării ideR au fost atenuate de o mutație supresoare a celui de-al doilea site și care a prezentat capacitate limitată de asimilare a fierului. Studiile acestei tulpini și un derivat în care s-a restabilit expresia IdeR ne-au permis să identificăm efectele fenotipice rezultate din inactivarea ideR. Folosind microarrays-urile de ADN, au fost analizate profilurile transcripționale dependente de fier ale tulpinilor mutante de tip sălbatic, ideR și complementate cu ideR și au fost identificate genele reglementate de fier și IdeR. Aceste gene codifică o varietate de proteine, inclusiv transportatori putativi, proteine ​​implicate în sinteza sideroforului și stocarea fierului, membri ai familiei PE / PPE, o proteină membranară implicată în virulență, regulatori transcripționali și enzime implicate în metabolismul lipidelor.

    Abstract

    La fel ca alte specii bacteriene, Mycobacterium tuberculosis are factori sigma multipli (sigma) codați în genomul său. În lucrările publicate anterior, noi și alții am arătat că mutațiile unora dintre acești activatori transcripționali fac M. tuberculosis sensibilă la diferite stresuri ale mediului și, în unele cazuri, determină fenotipuri de virulență atenuate. În această lucrare, caracterizăm un mutant M. tuberculosis lipsit de factorul sigma ECF sigma (H). Acest mutant a fost mai sensibil decât tipul sălbatic la șoc termic și la diverse stresuri oxidative, dar nu a arătat capacitatea scăzută de a crește în interiorul macrofagelor. Folosind tehnologia de transcriere inversă cantitativă-PCR și tehnologia microarray, am început să definim regulonul sigma (H) și implicarea acestuia în reglarea globală a răspunsului la șoc termic și a agentului oxidant diamol specific pentru tiol. Am identificat 48 de gene a căror expresie a crescut după expunerea la M. tuberculosis la diamidă dintre acestea, 39 nu au fost induse în mutantul sigH, arătând dependența lor directă sau indirectă de sigma (H). Unele dintre aceste gene codifică proteine ​​a căror funcție prezisă este legată de metabolismul tiolului, cum ar fi tioredoxina, tioredoxina reductaza și enzimele implicate în biosinteza cisteinei și molibdopterinei. Alte gene sub control sigma (H) codifică regulatori de transcripție, cum ar fi sigB, sigE și sigH în sine.

    Abstract

    Producerea de pili de tip IV care formează pachete (BFP) de către Escherichia coli enteropatogenă (EPEC) necesită produsele proteice din 12 gene ale operonului bfp cu 14 gene. Antiserurile împotriva fiecăreia dintre aceste proteine ​​au fost utilizate pentru a demonstra că ștergerea în cadru a genelor individuale din interiorul operonului reduce abundența altor proteine ​​codificate de operon bfp. S-a demonstrat că acest rezultat nu se datorează efectelor polare din aval ale mutațiilor, ci mai degrabă a fost luat ca dovadă pentru interacțiunile proteină-proteină și rolul lor în stabilizarea complexului de asamblare BFP. Aceste date, combinate cu rezultatele studiilor de localizare a compartimentului celular, sugerează că formarea pilusului necesită prezența unui complex de asamblare discret topografic care este compus din proteine ​​BFP în cantități stoichiometrice. Complexul de asamblare pare a fi format dintr-o membrană internă care conține trei proteine ​​procesate, de tip pilină, BfpI, -J și -K, care localizează cu BfpE, -L și -A (subunitatea principală a pilinei) o membrană exterioară, componentă secretinică, BfpB și -G și o componentă periplasmatică compusă din BfpU. Dintre acestea, numai BfpL se localizează în mod consecvent atât cu membranele interioare, cât și cu cele externe și astfel, împreună cu BfpU, se pot articula între proteinele Bfp din membrana interioară și compartimentele membranei exterioare.

    Abstract

    Factorii care sporesc transmiterea agenților patogeni în timpul răspândirii epidemiei sunt prost definiți. Răspândirea apei a bolii diareice holeră apare rapid în natură, în timp ce infecția voluntarilor umani cu bacterii crescute in vitro este dificilă în absența tamponării acidului stomacal. Cu toate acestea, nu este clar dacă aciditatea stomacului este un factor principal care contribuie la răspândirea epidemiei. Aici raportăm că caracterizarea Vibrio cholerae din scaunele umane susține un model prin care colonizarea umană creează o stare bacteriană hiperinfecțioasă care se menține după diseminare și care poate contribui la răspândirea epidemică a holerei. Profilarea transcripțională a lui V. cholerae din probele de scaun a relevat o stare fiziologică și comportamentală unică caracterizată prin niveluri ridicate de expresie ale genelor necesare pentru achiziția și motilitatea nutrienților și niveluri scăzute de expresie ale genelor necesare pentru chimiotaxia bacteriană.

    Abstract

    Profilarea expresiei microarray și dezvoltarea instrumentelor de extragere a datelor și a noilor instrumente statistice oferă o oportunitate fără precedent pentru studiul la scară genomică a patogenității bacteriene. Profilurile de expresie obținute din bacterii cultivate în medii simulând micro-medii gazdă oferă un portret al căilor metabolice interacționale și al programelor de dezvoltare pe mai multe etape și dezvăluie rețelele de reglementare.Analiza tulpinilor și speciilor strâns legate de genomica comparativă bazată pe microarray oferă o măsură a variabilității genetice în cadrul populațiilor naturale și identifică diferențe cruciale între agent patogen și comensal. În viitorul apropiat, utilizarea combinată a microarrays-urilor bacteriene și gazdă pentru a studia același țesut infectat va dezvălui dialogul gazdă-agent patogen într-o manieră genă cu genă și în funcție de sit și timp. Această revizuire discută utilizarea profilării expresiei pe bază de microarrays pentru a identifica genele bacteriilor patogene care sunt reglementate diferențial ca răspuns la semnale specifice gazdei. În plus, revizuirea descrie aplicarea metodelor de microarray pentru a dezvălui diferențele în conținutul de gene dintre tulpinile legate taxonomic, care variază în raport cu fenotipul patogen.

    Abstract

    Microarray-ul ADN, o suprafață care conține o dispunere ordonată a fiecărui cadru de citire deschis identificat al unui genom secvențiat, este motorul genomicii funcționale. Ieșirea sa, profilul de expresie, oferă un instantaneu larg al genomului transcriptomului. Rafinat de instrumente statistice specifice matricei și extrase de date prin algoritmi de grupare și baze de date ale căilor metabolice, profilul de expresie dezvăluie, la nivel transcripțional, modul în care microbul se adaptează noilor condiții de creștere - rețelele de reglementare care guvernează răspunsul adaptativ și căi metabolice și biosintetice care afectează noul fenotip. Adaptarea la micro-medii gazdă stă la baza capacității agenților infecțioși de a persista și de a deteriora țesuturile gazdă. În timp ce monitorizarea întregului răspuns transcripțional al genomului agenților patogeni bacterieni din țesuturile infectate nu a fost realizată, este probabil ca răspunsul complex, specific țesutului, să fie doar suma răspunsurilor individuale ale bacteriilor la caracteristici fizico-chimice specifice care caracterizează mediul gazdă. Acestea sunt susceptibile de experimentare in vitro, iar studiile de expresie a genomului întreg de acest gen au definit răspunsul transcripțional la înfometarea fierului, oxigen scăzut, pH acid, feromoni cu sensibilitate la cvorum și intermediari reactivi ai oxigenului. Acestea au dezvăluit noi informații despre procese chiar bine studiate și oferă un portret al bacteriei care se adaptează ca „sistem”, mai degrabă decât produsul câtorva gene sau chiar al câtorva reguloni. Printre genele reglementate care compun acest sistem adaptiv se numără factorii de transcripție. Experimentele de profilare a expresiei cu mutanți ai factorului de transcripție delimitează cascada de reglare corespunzătoare. Baza genetică pentru patogenitate poate fi, de asemenea, studiată utilizând genomica comparativă bazată pe microarrays pentru a caracteriza și cuantifica gradul de variabilitate genetică în cadrul populațiilor naturale la nivelul genei de rezoluție. De asemenea, sunt identificate diferențele dintre agentul patogen și comensal care indică posibili factori determinanți ai virulenței sau dezvăluie istoricul evolutiv. Gazda angajează energic studiile de exprimare a agenților patogeni utilizând microarrays ale genomului gazdă și culturile de celule infectate bacterian arată că reacția inițială a gazdei este dominată de răspunsul imun înnăscut. Cu toate acestea, în cadrul profilului de expresie complex al celulei gazdă sunt componente mediate de determinanți specifici patogeni. În viitor, utilizarea combinată a microarrays-urilor bacteriene și gazdă pentru a studia același țesut infectat va dezvălui dialogul dintre agent patogen și gazdă într-o manieră specifică genei cu gene și a sitului și timpului. Traducerea acestei conversații nu va fi ușoară și va necesita probabil o combinație de instrumente bioinformatice puternice și abordări experimentale tradiționale - și efort și timp considerabil.

    Abstract

    Activarea macrofagelor determină rezultatul infecției cu Mycobacterium tuberculosis (Mtb). Interferonul-gamma (IFN-gamma) activează macrofagele conducând Janus tirozin kinaza (JAK) / traductor de semnal și activator al inducției transcripției dependente de transcripție și suprimării traducerii dependente de PKR. Experimentele bazate pe microarray raportate aici măresc această imagine. Expunerea la IFN-gamma și / sau Mtb a dus la modificarea expresiei a 25% din genomul monitorizat în macrofage. Numărul de gene suprimate de IFN-gamma a depășit numărul de gene induse și o mare parte a suprimării a fost transcripțională. De cinci ori mai multe gene legate de imunitate și inflamație au fost induse decât suprimate. Mtb a mimat sau sinergizat cu IFN-gamma mai mult decât a antagonizat acțiunile sale. Fagocitoza Mtb neviabil sau perlele de polistiren au afectat multe gene, dar semnătura transcripțională a macrofagelor infectate cu Mtb viabil a fost distinctă. Studiile care implică macrofage cu deficit de oxid nitric sintază inductibilă și / sau fagocit oxidază au arătat că aceste două enzime antimicrobiene ajută la orchestrarea remodelării transcripționale profunde care stă la baza activării macrofagelor.

    Abstract

    Producerea de pili de tip IV care formează pachete de către Escherichia coli enteropatogenă (EPEC) necesită BfpB, o lipoproteină cu membrană exterioară și membru al superfamiliei proteinei secretinei. S-a găsit că BfpB compune un complex de membrană exterioară în formă de inel, cu greutate moleculară mare, care este stabil în 4% dodecil sulfat de sodiu la temperaturi de.

    Abstract

    În lucrările publicate anterior, am identificat trei gene factor Mycobacterium tuberculosis sigma (sigma) care răspund la șoc termic (sigB, sigE și sigH). Doi dintre ei (sigB și sigE) au răspuns, de asemenea, la expunerea SDS. Deoarece aceste răspunsuri la stres au sugerat că factorii sigma codați de aceste gene ar putea fi implicați în patogenitate, studiem rolul lor în fiziologie și virulență. În această lucrare, caracterizăm un sigE mutant al M. tuberculosis H37Rv. Tulpina sigE mutantă a fost mai sensibilă decât tulpina de tip sălbatic la șoc termic, SDS și diverse tensiuni oxidative. A fost, de asemenea, defect în capacitatea de a crește în interiorul macrofagelor umane și murine neactivate și a fost mai sensibil decât tulpina de tip sălbatic la activitatea de ucidere a macrofagelor murine activate. Folosind tehnologia microarray și reacția în lanț cantitativă cu transcripție inversă-polimerază (RT-PCR), am început să definim regulonul sigmaE al M. tuberculosis și implicarea acestuia în reglarea globală a stresului indus de SDS. Am arătat cerința unei gene funcționale sigE pentru exprimarea completă a sigB și pentru inducerea acesteia după expunerea la SDS, dar nu după șoc termic. De asemenea, am identificat mai multe gene care nu mai sunt induse atunci când sigmaE este absentă. Aceste gene codifică proteine ​​aparținând diferitelor clase, inclusiv regulatori de transcripție, enzime implicate în degradarea acizilor grași și proteine ​​clasice de șoc termic.

    Abstract

    Spre deosebire de mulți agenți patogeni care sunt în mod evident toxici pentru gazdele lor, determinantul principal al virulenței Mycobacterium tuberculosis pare a fi capacitatea sa de a persista ani sau zeci de ani în interiorul oamenilor într-o stare clinic latentă. De la începutul secolului al XX-lea latența a fost legată de condițiile hipoxice din cadrul gazdei, dar răspunsul M. tuberculosis la un semnal hipoxic rămâne slab caracterizat. Gena M. tuberculosis alfa-cristalină (acr) este indusă puternic și rapid la tensiuni reduse de oxigen, oferindu-ne un mijloc de a identifica regulatorii răspunsului hipoxic. Folosind un microarray de genom întreg, am identificat> 100 de gene a căror expresie este rapid modificată de condiții hipoxice definite. Numeroase gene implicate în biosinteză și metabolismul aerob sunt reprimate, în timp ce o proporție ridicată a genelor induse nu are nicio funcție cunoscută. Printre genele induse se află un operon aparent care include perechea supusă regulatorului de răspuns cu două componente Rv3133c / Rv3132c. Când am întrerupt exprimarea acestui operon prin întreruperea țintită a genei din amonte Rv3134c, a fost eliminată reglarea hipoxică a acr. Aceste rezultate sugerează un posibil rol pentru Rv3132c / 3133c / 3134c în latența micobacteriană.

    Abstract

    Varianta rugoasă colonială a Vibrio cholerae O1 El Tor produce o exopolizaharidă (EPS (ETr)) care permite organismului să formeze un biofilm și să reziste la stresul oxidativ și la acțiunea bactericidă a clorului. Mutageneza transposonică a variantei rugose a condus la identificarea vpsR, care codifică un omolog al subclasei NtrC a regulatorilor de răspuns. Întreruperea țintită a vpsR în fundalul genetic al coloniilor rugoase a produs un morfotip de colonii netede care nu a produs niciun EPS detectabil (ETr) și nu a format un biofilm arhitectural matur. Analiza a două gene, vpsA și vpsL, în grupul vps al genelor de biosinteză EPS (ETr) a relevat că expresia lor este indusă peste nivelurile bazale în varianta rugoasă, comparativ cu varianta colonială netedă și necesită vpsR. Aceste rezultate arată că VpsR funcționează ca un regulator pozitiv al vpsA și vpsL și astfel acționează pentru a regla pozitiv producția EPS (ETr) și formarea biofilmului.


    Discuţie

    Am conceput un sistem experimental complet reversibil pentru a studia plierea în echilibru a unei proteine ​​de membrană α-elicoidală în straturile stratificate lipidice. Acest lucru a permis prima determinare a stabilității termodinamice a acestei clase de proteine ​​într-un strat stratificat. Prin extinderea metodelor clasice de denaturare chimică, energia liberă de desfășurare a LeuT a fost măsurată din curbele de denaturare a ureei proteinei într-un strat strat lipidic. Dependența liniară a energiei libere care se desfășoară de concentrația de uree permite extrapolarea la denaturant zero și o valoare a energiei libere în absența ureei. Se știe că proprietățile mecanice ale membranei modulează plierea, funcția și stabilitatea proteinelor integrale ale membranei (3). Singurul exemplu anterior care leagă direct stabilitatea termodinamică a proteinelor membranelor de forțele membranei lipidice este pentru o proteină membranară externă bacteriană cu structură β-butoi (51 ⇓ –53). Energia liberă de desfășurare a LeuT este, de asemenea, dependentă de compoziția bistratului lipidic, indicând că stabilitatea structurii α-elicoidale este, de asemenea, cuplată cu proprietățile bistratului. Energia liberă de desfășurare a LeuT crește odată cu creșterea PE sau PG într-o bistrat PC, indicând faptul că atât presiunea laterală a lanțului, cât și grupurile de cap încărcate negativ sporesc stabilitatea termodinamică a LeuT, crescând magnitudinea energiei libere de desfășurare.

    S-a dovedit că ureea este un denaturant adecvat al transportoarelor de membrană α-elicoidale, cu curbe reversibile de denaturare care permit determinarea energiilor libere de desfășurare pentru stările pliate în micelele detergente. Acest lucru a fost demonstrat pentru membrii MFS, transportatorii galactozidici GalP și LacY din Escherichia coli (11, 12). În plus, ureea poate denatura aceste proteine ​​în straturile stratificate lipidice. Cu toate acestea, deși aceste proteine ​​MFS pot fi repliate înapoi în bistrat, nu a fost posibil să se stabilească replierea reversibilă pentru a permite măsurători de energie liberă. Recent s-a demonstrat că inserția, stabilitatea și funcționalitatea LacY au fost puternic influențate de proprietățile mecanice ale membranei (54), este posibil ca acest efect să se poată duce și la desfășurarea reversibilă a membranei. Transportorii MFS au structuri dinamice cu 12 spirale TM (55, 56) dispuse în două domenii, în timp ce cele 12 spirale ale LeuT sunt într-un aranjament înnodat (44). Ureea pare să denatureze proteinele MFS parțial prin intermediul site-ului de legare a substratului la interfața domeniului. Cu toate acestea, nu se știe cât din regiunile încorporate în membrană sunt afectate de uree și, prin urmare, natura tranziției care se desfășoară este neclară. În schimb, plierea și stabilitatea proteinelor membrana înnodate nu au fost studiate. Rezultatele de aici arată că LeuT este mai stabil decât proteinele MFS și nu există pierderi ale structurii secundare la adăugarea de uree la LeuT în straturile bistrat lipidice (prezentat în Anexa SI, Fig. S5A). Pentru a permite ureei să denatureze LeuT, o cantitate mică de detergent OG este adăugată la straturile biliare, de aproape 100 de ori mai mică decât CMC și de 10 ori mai mică decât cea utilizată pentru presaturarea lipozomilor în timpul reconstituirii. Adăugarea acestei cantități mici de detergent OG nu afectează structura sau faza lipozomilor, așa cum se vede în 31 P RMN și DLS, și nici nu modifică structura proteinelor. Cu toate acestea, OG se va împărți în bistrat, permițând ureei să inducă denaturarea LeuT. Este posibil ca OG să afecteze presiunea de ambalare laterală a bistratului înconjurător, similar cu un raport anterior (48). Starea redată cu succes și acordul curbelor de desfășurare și de îndoire sunt independente de OG.

    Stările denaturate de uree ale proteinelor MFS și LeuT sunt parțial structurate. Ureea de 8 M induce o reducere de 30% a structurii α-elicoidale pentru proteinele GalP și LacY MFS, în timp ce LeuT pierde helicitatea de 35% la denaturarea ureei de 8 M în micelele DDM sau helicitatea de 30% în DOPC / DOPE (4: 1 mol raport) în prezența 0,29 mM OG. Capacitatea ureei de a denatura LeuT depinde de compoziția lipidică. Creșterea presiunii laterale a lanțului lipidic și a încărcării grupului de cap crește stabilitatea LeuT la 8 M uree. O reducere mai mică a helixului se observă la adăugarea de 8 M uree la lipozomii DOPC cu cantități crescânde de DOPE sau DOPG (Anexa SI, Tabelul S2). LeuT suferă doar o reducere de 10% a structurii elicoidale în lipozomii încărcați care conțin atât lipide DOPE, cât și lipide DOPG la adăugarea de 8 M uree. LeuT a fost funcțional în toți lipozomii studiați, dar a pierdut activitatea de transport când s-a adăugat uree și a recâștigat & gt 90% activitate de transport și conținutul de structură secundară originală la reînfășurarea în lipozomi (0,8 M uree, 0,04 nM OG), indicând că replierea este extrem de eficientă.

    Energia liberă pentru desfășurarea LeuT în DDM, extrapolată la zero denaturant de uree, ΔGU H2O, se găsește a fi +3,1 ± 0,26 kcal · mol −1. Aceasta este mai mare decât ΔGU H2O determinat în DDM pentru GalP și LacY, care sunt ambele aproximativ +2,5 kcal⋅mol -1. Energia liberă de desfășurare a LeuT atunci când este reconstituită în DOPC / DOPE (raport 4: 1 mol) ΔGU H2O se dovedește a fi +2,6 ± 0,1 kcal⋅mol -1, care este mai mic decât ΔGU H2O de LeuT în micelele de detergent. Aceasta ΔGU H2O pentru LeuT crește la +2,9 ± 0,2 kcal · mol -1 în DOPC / DOPE (raport 1: 1 mol) atunci când concentrația DOPE și presiunea laterală a lanțului sunt crescute (Fig. 5). O creștere suplimentară se observă dacă este introdusă sarcina în straturile bilaterale DOPC, cu ΔGU H2O fiind de +3,8 ± 0,23 kcal⋅mol −1 în straturile bilaterale DOPC / DOPG (raport 1: 1 mol).

    ΔGU Valorile energiei libere H2O menționate sunt destinate desfășurării în straturile bilidice lipidice fără prezență de uree și pentru reacția de desfășurare dintre starea pliată și starea parțial desfăcută. Singura informație structurală pentru această ultimă stare desfășurată în uree este structura secundară, determinată din CD-ul cu ultra-UV. Stările desfășurate pentru DOPC / DOPE conțin 70% din conținutul α-elicoidal pliat complet. LeuT este mai rezistent la desfășurarea în uree atunci când se află în straturile bilaterale DOPC / DOPG, păstrând 80% din conținutul α-elicoidal pliat în uree de 8 M. În ciuda gradului mai mare de structură prezent în starea desfășurată în straturile bilaterale DOPC / DOPG, energia liberă de desfășurare a LeuT este mai mare în DOPC / DOPG decât DOPC / DOPE. Astfel, încărcarea grupului de cap joacă un rol semnificativ în stabilitatea termodinamică a LeuT. Introducerea DOPE în straturile bilaterale DOPC are ca rezultat o schimbare mică în helicitatea stării desfășurate, dar o creștere a energiei libere care se desfășoară, arătând că presiunea laterală a lanțului influențează și stabilitatea LeuT. Acest lucru este în concordanță cu previziunile anterioare că presiunea crescută a lanțului ar stabiliza un pachet elicoidal.

    Stările complet denaturate din clasa α-elicoidală a proteinelor de membrană sunt rareori întâlnite in vivo și nici stările complet denaturate nu pot fi utilizate în studii de reîncărcare a echilibrului. Stările parțial denaturate in vitro au permis stabilirea echilibrelor de pliere și determinarea energiei libere asociate (57). Nu toate proteinele de membrană elicoidală pot fi denaturate de uree sau detergenți duri, cum ar fi SDS, iar pentru cei care sunt, doar câțiva pot fi repliați din aceste stări parțial denaturate. Prin urmare, interacțiunile și structura cheie sunt prezente probabil în stările parțial denaturate care pot fi repliate cu succes în lipide, în timp ce lipsa replierii este foarte probabil să reflecte agregarea (36, 58). SDS a fost primul denaturant utilizat pentru măsurători termodinamice ale proteinelor de membrană elicoidală (14). În ceea ce privește stările denaturate cu uree, structura reziduală în starea SDS-denaturată a proteinelor de membrană nu este bine înțeleasă. bR este cel mai bine caracterizat în ceea ce privește studiile de pliere, cu CD ultraviolet care indică o reducere semnificativă a helicității (21, 23) și DEER sugerând o reducere mai mică a structurii helixului și pierderea mai mult sau mai puțin completă a interacțiunii elice, terțiale cu helix (59 ). Sunt disponibile mai puține informații directe pentru stările denaturate SDS ale altor proteine ​​care au făcut obiectul unor studii de desfășurare, de exemplu, GlpG în SDS nu prezintă pierderi ale structurii elicoidale și foarte puține modificări în banda de emisie a fluorescenței, ceea ce în orice caz este dificil de atribuit schimbare structurală definitivă (10, 60, 61).

    Utilizarea denaturării ureei în studiile transportatorilor de membrană conferă un sistem cu denaturare elicoidală clară și ușurință de reînfășurare prin diluare direct în straturile bilidice lipidice. Nu găsim aici dovezi ale ureei (sau OG la concentrațiile mult sub CMC) care să afecteze faza lipidică a lipozomilor prin DLS sau 31 P RMN. Mai mult decât atât, relațiile liniare de energie liberă sunt observate pentru LeuT la straturile bistratificate cu o gamă largă de concentrații de uree, așa cum sa observat anterior pentru proteinele MFS din detergent (11, 12). Abordarea combinată a ureei, OG (sau detergent ușor) pentru a dezvolta proteina în stratul bistrat, așa cum este utilizată aici, s-ar putea dovedi a fi un punct de plecare pentru viitoare studii termodinamice asupra altor proteine ​​de membrană elicoidală. Cu toate acestea, întrucât diferite proteine ​​au dependențe diferite de proprietățile bistraturii lipidice, lipidele exacte, detergenții și concentrațiile utilizate vor avea nevoie de optimizare. Avantajul major al abordării mixte uree / OG față de abordările pe bază de solvenți, cum ar fi trifluoroetanolul (TFE), este că membrana este păstrată intactă, permițând reîncărcarea în straturi bistratice. Problemele potențiale cu SDS și TFE includ capacitatea ambelor de a induce structura α-elicoidală în lanțurile polipeptidice (chiar și acolo unde nu există helici nativi), precum și perturbarea și solubilizarea bistratului (62, 63).

    Influența puternică a mediului solubilizant asupra stabilității termodinamice face dificilă compararea energiei libere absolute a valorilor de desfășurare pentru diferite proteine ​​de membrană. Cu toate acestea, este posibil să se facă anumite evaluări. Pe lângă comparații valabile între energiile care se desfășoară pentru LeuT în diferite straturi stratificate lipidice, această lucrare permite o comparație a energiei libere desfășurate a LeuT în micelele detergente și straturile lipidice.Există puțină diferență în energia liberă a stării LeuT pliate în DDM în comparație cu cea din bistraturile DOPC / DOPE, cu referire la o stare desfășurată cu 60-65% conținut nativ elicoidal. Cu toate acestea, stabilitatea LeuT este mai mare în straturile bilaterale DOPG / DOPE decât micelele DDM. Solventul din jur are o influență clară asupra dinamicii și stabilității proteinelor de membrană și nu se cunoaște natura exactă a interacțiunilor subiacente în micele în comparație cu bistratele. Prin urmare, detergenții stabilizatori sunt folosiți în mod inerent în timpul purificării proteinelor de membrană, dar găsirea unui strat strat lipidic care să asigure o stabilitate optimă necesită o manipulare considerabilă a compoziției lipidice (64). De asemenea, s-a demonstrat anterior că dimerul glicoforinei TM poate fi mai stabil în micelele de detergent decât straturile lipidice (27).

    LeuT este originar din Archea Aquifex aeolicus unde fosfatidilcolina este rară (65) și, prin urmare, este posibil ca lipida să nu fie la fel de eficientă în stabilizarea proteinei din stratul bicomponent ca și celelalte compoziții studiate. Mai mult, trebuie luat în considerare faptul că lipidele din membrana Archea sunt semnificativ mai ramificate în regiunea acil (66) decât fosfolipidele sintetice pe care le-am folosit și o astfel de ramificare poate juca un rol în determinarea stabilității proteinei în stratul bistrat. Comparațiile termodinamice aici în straturile bilaterale PC / PE / PG arată că sarcina și presiunea laterală sunt importante și pot crește stabilitatea termodinamică a LeuT față de cea din micele. În conformitate cu acest rol de încărcare, grupul principal de zahăr polar al DDM poate conferi stabilitate LeuT, conferindu-i stabilitate similară cu cea dintr-o bistrată neutră. Acest lucru oferă dovezi suplimentare care indică faptul că comparațiile directe între detergent, bistrat și alte medii nu sunt neapărat simple.

    Fig. 6 arată ΔGU Valorile H2O obținute aici în straturile stratificate comparativ cu rapoartele existente pentru proteinele de membrană din micelă și bicelă. Există doar un număr mic de exemple de măsurători ale stabilității termodinamice pentru proteinele de membrană (Anexa SI, Tabelul S3). Valorile sunt obținute în condiții experimentale diferite și folosind abordări și ipoteze diferite. Energiile libere care se desfășoară au fost determinate pentru LeuT în straturile stratificate lipidice (ΔGU H2O variind de la +2,5 la +3,8 kcal⋅mol −1) sunt de ordinul de mărime similar cu cel pentru LeuT în micelele, precum și cele raportate anterior pentru proteinele MFS GalP și LacY în micelele detergente (11, 12). Valorile prezentate pentru transportorii multi-domenii α-elicoidali desfășurați de uree sunt mai mici decât măsurătorile de stabilitate efectuate pentru unele proteine ​​de membrană elicoidală cu un singur domeniu în micele sau biceluri folosind SDS ca denaturant. Pentru cazurile în care s-a demonstrat că SDS induce desfășurarea parțială a structurilor elicoidale [oferind stări denaturate cu conținut de ~ 65% sau 80% din helix nativ atât pentru bR, cât și pentru diacil glicerol kinază (DGK)], valori de +20,6 și +16 kcal⋅ mol −1 au fost raportate pentru ΔGU H2O pentru bR (23) și DGK trimeric, respectiv (14). Extrapolarea liniară lungă poate supraestima valoarea de energie liberă de +20,6 kcal⋅mol −1 bR, cu măsurători de captare sterică raportând +11 kcal⋅mol −1 (67). Stările de desfășurare și reacțiile de pliere ale bR sunt complexe și există diferite etape de legare a cofactorului retinal. Denaturarea SDS la echilibru și captarea sterică măsoară probabil diferite reacții de pliere, cu o stare disimilară desfășurată prinse steretic prin legarea streptavidinei comparativ cu cea obținută prin denaturarea SDS (inclusiv în ceea ce privește legarea retinei). Legarea retinei ar putea explica, de asemenea, o stabilitate crescută față de alte proteine. Energia liberă pentru legarea retiniană noncovalentă (și plierea proteinelor asociate) a fost determinată ca -7 kcal⋅mol -1 (68), iar stabilizarea ulterioară se presupune că are loc în timpul legării covalente și plierea finală, pentru care a fost raportată o modificare a entalpiei de -95 kcal⋅mol -1 în membrane (69). Există, de asemenea, rapoarte despre desfășurarea energiilor libere în micelele de detergent folosind SDS ca denaturant pentru DsbB și GlpG, cu ΔGU Valorile H2O de +4,4 și +8,2 kcal⋅mol -1 (60, 70). În ambele cazuri din urmă, nu există o reducere a structurii elicoidale în starea denaturată SDS și puține informații despre structura terțiară, prin urmare natura reacției de desfășurare / pliere este mai puțin sigură. Captarea sterică oferă o energie liberă de desfășurare mai mică de +5,8 kcal⋅mol -1 sau +4,7 kJ⋅mol -1 pentru GlpG în micelele detergente (în funcție de locul mutațiilor Cys pentru atașarea etichetelor duble de biotină) (71), în timp ce o valoare de +3,9 kcal⋅mol -1 a fost dedusă la forța zero aplicată din studiile inovatoare de desfășurare mecanică (72).

    Valorile calculated calculateGU Valorile H2O pentru proteinele de membrană extrapolate din curbele de desfășurare primele exemple notabile au fost adnotate pe figura tuturor valorilor sunt rezumate în Anexa SI, Tabelul S1. Cercurile indică proteinele α-helix, în timp ce pătratele indică β-butoaie. În plus, culoarea indică membranele mimetice utilizate fie detergent (alb), biceluri (verde), fie bistrat lipidic (albastru). Tăierea verticală indică faptul că captarea sterică a fost utilizată pentru a genera ΔGU Tracțiunea diagonală H2O indică faptul că s-a folosit desfășurarea mecanică. Pentru proteinele α-elicoidale: DGK este un trimer, dar valoarea obținută a fost pentru monomer (14), KcsA este un tetramer și valoarea obținută se referă la tranziția tetramer-la-monomer (62), structura bR este stabilizată de un cofactor ( 23), DsbB (70) și GlpG (60) din zona proteinei α-elicoidale cu un singur domeniu, GalP (11), LacY (12) și LeuT sunt proteine ​​α-elicoidale cu mai multe domenii. Pentru β-butoaie: OmpA a fost primul ΔGU H2O generat pentru o proteină într-un strat stratificat (52, 53), urmat de PagP * măsurat cu un N-terminal his tag (74), urmat de eliberarea OmpLA (74), OmpW (74) și PagP (74) . ΔGU H2O de GlpG au fost, de asemenea, calculate folosind metode noi, cum ar fi captarea sterică (cu ΔGU H2O pentru 95/172N-BtnPyr2 varianta prezentată) (71) și desfășurarea mecanică (72).

    Nu există alte măsurători ale energiei libere termodinamice care se desfășoară pentru proteinele din membrană elicoidală în straturile stratificate lipidice. Există valori pentru proteinele de membrană β-baril (51 ⇓ –53). Proteinele β-structurate sunt, în general, mai puțin hidrofobe și pot fi deseori complet denaturate în uree, iar unele au fost îndoite reversibil în straturi bilaterale, dând energia liberă asociată reacției de desfășurare. Proteinele β-baril au, de asemenea, stabilități termodinamice, care sunt modulate de proprietățile bistratului (53). Membrana nativă a majorității proteinelor de butoi studiate este membrana exterioară a E coli, care conține lipopolizaharidă în principal într-un prospect bistrat exterior mai subțire și este îmbogățit în PE în prospectul interior (73). Studiile pe butoaie s-au concentrat asupra lipidei bistrat non-native, POPC, în condiții diferite. A ΔGU S-a găsit H2O de +3,4 kcal⋅mol -1 pentru proteina mp-baril OmpA și stabilitatea termodinamică s-a dovedit, de asemenea, să crească odată cu creșterea conținutului de PE (53). Rezultatele noastre pe LeuT arată că o creștere a presiunii laterale a lanțului, cauzată de introducerea PE în bistrat PC, mărește stabilitatea termodinamică a structurilor TM cu β-butoi și α-elicoidale. Anexa SI, Tabelul S3 și revizuirea (74) oferă alte valori obținute pentru proteinele β-baril în straturile bilayer într-o varietate de condiții.

    În ciuda progreselor semnificative, proteinele de membrană elicoidală rămân sever subreprezentate în studiile de pliere a proteinelor. Experimentele pe straturi de două straturi sunt esențiale pentru a înțelege plierea proteinelor de membrană. Progresele raportate aici permit în cele din urmă comparații ale stabilității termodinamice într-un strat stratificat. Acest lucru are ramificații importante. Pe lângă faptul că oferă o perspectivă asupra cuplării stabilității termodinamice a proteinelor la mecanica și sarcina bistratului, va permite, de asemenea, compararea efectului mutațiilor asupra desfășurării energiilor libere. La rândul său, combinat cu măsurători cinetice, acesta are potențialul de a oferi informații despre intermediarii de pliere și stările de tranziție în straturile bistratice prin analize ale valorii ϕ (23). Pliul LeuT conține un nod de trifoi complex care implică 55% din totalul aminoacizilor 278 aa dintr-un total de 511 aa din proteina din reziduul 15–293 care cuprinde primele șapte spirale (prezentate în Anexa SI, Fig. S1A, eu). LeuT se desfășoară în mod reversibil, pierzând până la 40% din structura secundară atât în ​​condiții de detergent, cât și în două straturi. Nu este clar cât de mult din nod este perturbat de uree. Sunt necesare lucrări suplimentare, de exemplu folosind mutageneză, coroborat cu abordarea descrisă aici pentru a identifica modul în care reziduurile din diferite regiuni ale nodului influențează energia liberă a LeuT.

    Studiile cu două straturi sintetice oferă, de asemenea, informații care nu pot fi obținute în membranele celulare și sunt o comparație mai informativă decât sistemele de detergenți. Deși această lucrare mută proteina membranară elicoidală care se pliază către termodinamică și mecanismul în straturi bistratale, provocările nu trebuie subestimate. Dificultățile sunt ilustrate în timpul necesar pentru a ajunge la acest punct în care măsurătorile pot începe acum în straturile bilidice lipidice. Studiile pliabile au început pe proteinele de membrană elicoidală la sfârșitul anilor 1980 (20), urmate un deceniu mai târziu de stabilirea denaturării chimice pentru a testa termodinamica în detergent (14, 75) și un alt deceniu mai târziu de primele analize ale valorii ϕ pentru a investiga stările de tranziție în bicele (23). Cu toate acestea, la încă 9 ani, raportăm abilitatea de a determina stabilitatea termodinamică în straturile bilidice lipidice. Mai degrabă decât să ne concentrăm pe un model mic de proteine ​​și pentru ca rezultatele să fie mai informative, ne-am asigurat în mod deliberat că sistemul funcționează pentru proteina membrana înnodată LeuT, un paralog al transportatorilor de neurotransmițători umani.


    Materiale și metode

    Paraziții malariei

    P. falciparum paraziții (3D7) au fost menținuți în cultură continuă in vitro în eritrocite umane suspendate în RPMI 1640 tamponat cu Hepes suplimentat cu 0,5% AlbumaxII utilizând proceduri standard (Cranmer și colab., 1997). Culturile au fost menținute sincrone, iar fenotipul cu buton pozitiv a fost menținut prin plutire cu gelatină (Waterkeyn și colab., 2001). Liniile parazitare clonale au fost derivate prin metoda de limitare a diluției.

    Constructe plasmidice

    Pentru a perturba sbp1 genă în paraziți 3D7, secvențe de 5 ′ și 3 ′ de kb1 kb care flancează sbp1 gena au fost clonate în P. falciparum plasmida de transfecție pHHT-TK (cadou de la A. Cowman și B. Crabb, Institutul Walter și Eliza Hall, Melbourne, Australia Duraisingh și colab., 2002) pentru a obține pHTKΔsbp1 (Fig. 2 A). Mai exact, segmentul 5 ′ al sbp1 (incluzând 458 pb din secvența netradusă de 5 ′) a fost amplificată din ADN genomic de la paraziți 3D7 folosind primeri înainte și invers 5′TC CCCGCGG cgatacaaccctccttttatg3 ′ (site SacII subliniat) și 5′GG ACTAGT gacatagattcggctgga3 ′ (site SpeI subliniat), respectiv, și a fost subclonat în siturile SacII și SpeI ale pHHT-TK în amonte de hdhfr casetă de rezistență. Segmentul 3 ′ al sbp1 (incluzând 437 pb din secvența netradusă de 3 ′) a fost amplificată folosind primerii înainte și invers 5′CG GAATTC gcagattttgcaaaacaagc3 ′ (site EcoRI subliniat) și 5′CATG CCATGG catatacataaacgatcaaaaag3 ′ (respectiv site NcoI subliniat) și a fost introdus în site Siturile EcoRI și NcoI din aval de hdhfr casetă. ADN-ul plasmidic a fost amplificat în Escherichia coli și purificat folosind MegaPrep (QIAGEN).

    Pentru completare, lungimea completă sbp1 gena (cu excepția codonului stop) a fost amplificată prin PCR din ADNc 3D7 utilizând primerii înainte și invers 5′CACCTATATACAatgtgtagcgcagctcgagca3 ′ și respectiv ggtttctctagcaactgtttttg și a fost clonată folosind topoizomerază în vectorul de intrare Gateway multisite pENTRitr / D-TOPO. Acesta a fost recombinat împreună cu vectorul pDONR P4-P1R care conține P. falciparum Hsp86 promotor și vectorul pDONR P2R-P3 care conține gena reporter EYFP într-un vector de destinație, pHrB1-1 / 2, care fusese modificat anterior pentru utilizare în P. falciparum (van Dooren și colab., 2005) pentru a produce plasmida de expresie pHrB1-1 / 2-sbp1.

    Transfecția cu paraziți

    Paraziții din stadiul inelar au fost transfectați prin electroporare cu 150 μg de ADN plasmidic supercolurat purificat (pHTkΔsbp1) diluat în citomix conform procedurilor standard (Wu și colab., 1996) dar folosind condiții de electroporare modificate pentru a spori livrarea ADN (Fidock și Wellems, 1997). Paraziții transfectați au fost cultivați în prezența a 2,5 nM a medicamentului antifolat WR99210 (Fidock și Wellems, 1997) timp de ~ 30 de zile până când s-au observat paraziți viabili în frotiurile colorate cu Giemsa. S-a adăugat apoi 4 μM ganciclovir (Roche Diagnostics) pentru a selecta paraziții care au doar recombinare omologă încrucișată dublă (Duraisingh și colab., 2002). Pentru completare, selecție pozitivă pentru paraziți transformați cu pHrB1-1 / 2-sbp1 a fost efectuat folosind 8 μM clorhidrat de blasticidină S (Calbiochem) așa cum s-a descris anterior (Mamoun și colab., 1999).

    Extracția ADN și Southern blot

    ADN-ul genomic a fost extras din cultura de paraziți folosind kitul Nucleon BACC2 (GE Healthcare), digerat cu ClaI și EcoRI, separat pe geluri de agaroză 1% și transferat pe membranele de nailon. Hibridizarea Southern blot a fost efectuată utilizând proceduri standard.

    Western blot

    IRBC-urile cultivate au fost recoltate pe Percoll și solubilizate într-un tampon de probă SDS reducător de 2 ori care conține un cocktail inhibitor de protează (Roche Diagnostics). Aceste extracte totale de paraziți au fost separate pe geluri SDS-PAGE 10% și transferate în membranele de difluorură de poliviniliden (PVDF). Membranele au fost sondate cu anticorpi policlonali anti-HSP70 (1: 10.000) de iepure, anti-SBP1 policlonali de șoarece (1: 400) sau anticorpi monoclonali antiglicoforină C de șoarece (1: 500 Sigma-Aldrich). Detectarea prin chemiluminescență sporită (Lumi-light Western blot substrat Roche Diagnostics) a fost efectuată după detectarea secundară fie cu ovine anti-iepure, fie cu ovine anti-șoarece Ig-HRP conjugat (1: 2.000 Silenus).

    Analiza expresiei PfEMP1 pe suprafața IRBC-urilor prin testul de scindare a tripsinei

    Testul de scindare a tripsinei a fost efectuat așa cum s-a descris anterior (Waterkeyn și colab., 2000) pentru a vizualiza PfEMP1 exprimat pe suprafața IRBC. Pe scurt, IRBC-urile mature au fost îmbogățite pe Percoll așa cum s-a descris anterior (Dluzewski și colab., 1984) și au fost incubate cu 100 μg / ml tripsină tratată cu TPCK (Sigma-Aldrich) în prezența sau absența 1 mg / ml inhibitor de tripsină din soia (STI Sigma-Aldrich) timp de 15 minute la 37 ° C. Reacțiile au fost oprite prin adăugarea de STI la o concentrație finală de 1 mg / ml urmată de o incubare suplimentară de 15 min la temperatura camerei. Proteinele de membrană (inclusiv PfEMP1) au fost extrase folosind Triton X-100 și solubilizare SDS așa cum s-a descris anterior (Van Schravendijk și colab., 1993) și diluate în reducerea tamponului probei Laemmli. Probele au fost separate pe geluri SDS-PAGE 6% și transferate timp de 4 ore la 4 ° C pe membrane PVDF. Coada citoplasmatică a PfEMP1 (VARC) a fost detectată folosind anticorpul monoclonal de șoarece 1B / 98-6H1-1 (cadou 1: 100 de la Institutul Walter și Eliza Hall).

    Fluorescență și microscopie confocală

    Pentru imunofluorescența indirectă, eritrocitele cultivate au fost fixate în suspensie cu 4% PFA conținând 0,0075% glutaraldehidă în PBS, permeabilizate cu 0,1% Triton X-100 și blocate cu 3% BSA în PBS așa cum s-a descris anterior (Tonkin și colab., 2004). Celulele au fost apoi incubate timp de 1 oră cu șoarece policlonal anti-SBP1 (1: 500), policlonal anti-KAHRP (1: 500), policlonal anti-Pf332 (1: 200), policlon anti-REX-1 ( 1: 2.000 cadou de la D. Gardiner, Queensland Institute of Medical Research, Brisbane, Australia), șoarece policlonal anti-MAHRP-1 (1: 200 cadou de la C. Spycher și H.-P. Beck, Swiss Tropical Institute, Basel, Elveția), sau anti-GFP policlonal de iepure (1: 1.000 Invitrogen). Pentru localizarea PfEMP1 utilizând anti-VARC policlonal de iepure (1: 100), detectarea a fost efectuată folosind frotiuri subțiri de cultură care au fost uscate la aer și fixate cu acetonă / metanol rece (9: 1) deoarece acest anticorp a prezentat o reactivitate slabă atunci când a fost utilizat pe RBC a fost fixat cu PFA / glutaraldehidă în suspensie folosind metoda lui Tonkin și colab. (2004). Anticorpii primari au fost apoi detectați utilizând fie IgG anti-șoarece, fie anti-iepure conjugat cu AlexaFluor488 sau -568 (Invitrogen) și vizualizați folosind un microscop confocal cu scanare laser (model TCS NT Leica) echipat cu un laser krypton / argon (488/568 nm). Capul de scanare confocal a fost montat pe un microscop inversat (model DM RBE Leica) echipat cu un plan de petrol 100 × NA 1.4-obiectiv Apo. Toate imaginile RBC individuale prezentate în figuri sunt reprezentative pentru numeroase RBC similare în mai multe câmpuri vizuale. Fluorescența verde a transformanților care exprimă EYFP a fost observată folosind RBC-uri vii nefixate direct din cultură sub lumină de 513 nm folosind un microscop de fluorescență (BX51 Olympus).

    Analiza morfometrică a butoanelor și a fisurilor lui Maurer prin microscopie electronică

    RBC-urile din culturi sincrone care conțin paraziți în stadiu predominant maturi (trofozoizi târzii / schizonti tineri) au fost fixate prin diluarea RBC-urilor ambalate în PBS izotonică conținând 2,5% (vol / vol) glutaraldehidă de microscopie electronică (Sigma-Aldrich). După proceduri de pregătire de rutină (Bannister și colab., 2003), secțiuni ultra-subțiri au fost pregătite pentru microscopie electronică de transmisie și granulate pentru SEM. Imaginile aleatorii ale IRBC au fost capturate digital la o mărire de 20.000 × într-un microscop electronic (H7600 Hitachi) și analizate folosind software-ul Scion Image (v4.0.2). Butoanele cu densitate de electroni și fantele lui Maurer au fost numărate manual pentru fiecare IRBC. Un total de 32 IRBC au fost examinate pentru fiecare dintre liniile de paraziți 3D7 și 1G8. Parametrii măsurați au fost (1) perimetrul fiecărui IRBC, (2) aria secțiunii totale a fiecărui IRBC și (3) aria secțională a parazitului (dacă au fost prezenți mai mulți paraziți, ariile lor au fost adăugate împreună). Din al doilea și al treilea parametru, aria IRBC externă a parazitului a fost obținută prin scădere. Butoanele și fantele lui Maurer au fost numărate manual pentru a determina frecvența lor.

    Testele de adeziune IRBC

    Proprietățile adezive ale IRBC au fost cuantificate utilizând atât teste statice, cât și teste bazate pe flux. Culturile de paraziți au fost testate atunci când majoritatea paraziților erau trofozoizi pigmentați, după cum au fost evaluați prin frotiuri colorate cu Giemsa. RBC cultivate au fost resuspendate în tampon de adeziune (RPMI 1640 tamponat cu Hepes suplimentat cu 1% BSA și pH ajustat la 7,0) la o concentrație de ± 3 × 108 RBC / ml pentru teste de aderență statică sau 1,5 × 108 RBC / ml pentru flux - teste pe bază. Pentru toate testele de aderență, parazitemia a avut în medie ∼4,4% trofozoizi (interval de 2,2-7,8%).Testele statice au fost efectuate în cutii Petri de 36 mm așa cum s-a descris anterior (Beeson și colab., 1998), cu excepția faptului că CD36 recombinant purificat (sisteme R & ampD) a fost imobilizat ca receptor țintă (100 μg / ml). Aderența la CD36 în condiții de curgere care imită cele din venulele postcapilare a fost vizualizată și cuantificată in vitro prin observare microscopică directă la microscop (IMT-2 Olympus) cu un obiectiv de 40 × imersiune în apă (Olympus) folosind tuburi microcapilare de sticlă plate, dreptunghiulare (Microslides) VitroCom, Inc.) conectat la un sistem de control al fluxului așa cum s-a descris anterior (Cooke și colab., 2002a, b).

    Material suplimentar online

    Fig. S1 prezintă rezultatele din experimentele de imunoprecipitare și FRET pentru a demonstra că nu există nicio interacțiune moleculară directă între SBP1 și PfEMP1 în IRBC infectate cu paraziți 3D7. Textul suplimentar oferă detalii despre aceste experimente FRET și imunoprecipitare.


    Cum se leagă glicoforina A și straphylococcal de Escherichia coli și ce înseamnă purificarea ușoară în acest context? - Biologie

    Oligomerizarea proteinelor anvelopei virale este esențială pentru controlul asamblării și fuziunii virusului. S-a demonstrat că domeniile transmembranare (TMD) ale glicoproteinelor E1 și E2 din învelișul virusului hepatitei C joacă mai multe funcții în timpul biogenezei heterodimerului E1E2. Acest lucru le face foarte unice printre secvențele transmembranare cunoscute. În acest raport, am folosit mutageneză de inserție prin scanare alanină în TMD-urile E1 și E2 pentru a examina rolul lor în asamblarea heterodimerului E1E2. Inserarea alaninei în centrul TMD-urilor E1 sau E2 sau în partea N-terminală a TMD-ului E1 a redus dramatic heterodimerizarea, demonstrând rolul esențial jucat de aceste domenii în asamblarea glicoproteinelor din plic ale virusului hepatitei C. Pentru a înțelege mai bine datele de scanare a alaninei obținute pentru TMD de E1 care conține GXXXMotivele G, am analizat prin dicroism circular și rezonanță magnetică nucleară structura tridimensională a peptidei E1- (350-370) care cuprinde secvența N-terminală a TMD a E1 implicată în heterodimerizare. Rezultatele scanării alaninei și modelul molecular tridimensional pe care l-am obținut oferă primul cadru pentru o înțelegere la nivel molecular a mecanismului heterodimerizării glicoproteinei învelișului virusului hepatitei C.

    Publicat, JBC Papers in Press, 11 mai 2000, DOI 10.1074 / jbc.M003003200

    Această lucrare a fost susținută de CNRS, Institutul Pasteur de Lille, Fondul European de Dezvoltare Regională (FEDR), un grant PRFMMIP de la Ministerul francez al Cercetării, grantul Uniunii Europene QLK2-1999-00356 și Association pour la Recherche sur le Cancer (ARC) ) Grant 9736. Sprijinul a fost oferit și de o bursă din partea ARC și Agenția Națională a Cercetării pe Sida (ANRS) (către AODB). Costurile de publicare a acestui articol au fost suportate parțial prin plata taxelor de pagină. Prin urmare, articolul trebuie marcat prin prezenta „publicitate”În conformitate cu 18 U.S.C. Secțiunea 1734 doar pentru a indica acest fapt.

    Coordonatele atomice pentru structura RMN a fragmentului E1- (350-370) și restricțiile RMN sunt disponibile în cadrul Colaboratorului de cercetare pentru Banca de date proteice de bioinformatică structurală sub numărul de acces (RCSB010735). Schimbările chimice de protoni ale tuturor reziduurilor au fost depuse în BioMagResBank (BMRB) sub numărul de acces 4699.


    Imunoconjugatele invenției

    Un alt aspect al invenției se referă la un imunoconjugat care cuprinde VHH conform invenției conjugat la cel puțin un compus chimic.

    Imunoconjugatul conform invenției rezultă din cuplarea chimică a VHH la compusul chimic, fie direct, fie opțional printr-un linker, pentru a forma un conjugat. Mutația VHH pentru a introduce o cisteină suplimentară în secvență, de preferință, dar nu exclusiv la capătul C-terminal este prevăzută ca o modalitate ușoară de a cupla compușii chimici cu VHH.

    Astfel de conjugat se obține prin cuplare (fie prin cuplare covalentă sau necovalentă) a VHH cu compusul chimic, opțional printr-un linker.

    Legătura covalentă între VHH și compusul chimic este obținută în mod obișnuit prin utilizarea unui cuplaj sau agent de reticulare și, opțional, un linker pentru legătura covalentă a ambelor molecule, menținând în același timp funcționalitatea acestora sau permițând scindarea. O varietate de agenți de cuplare sau reticulare poate fi utilizată pentru fabricarea imunoconjugaților conform invenției. Exemple de agenți de reticulare includ carbodiimidă, N-succinimidil-S-acetil-tioacetat (SATA), 5,5'-ditiobis (acid 2-nitrobenzoic) (DTNB), o-fenilendimaleimidă (oPDM), N-succinimidil-3 - (2-piridilditio) propionat (SPDP) și sulfosuccinimidil 4- (N-maleimidometil) ciclohaxan-1-carboxilat (sulfo-SMCC) (vezi de exemplu Karpovsky și colab., 1984 J. Exp. Med. 160: 1686 Liu, MA și colab., 1985 Proc. Natl. Acad. Sci. USA 82: 8648). Alte metode includ cele descrise în Paulus, 1985 Behring Ins. Mitt. Nr. 78,1 18-132 Brennan și colab., 1985 Science 229: 81-83) și Glennie și colab., 1987 J. Immunol. 139: 2367-2375). Exemple de tipuri de linkeri includ, dar nu se limitează la, hidrazone, tioeteri, esteri, disulfuri și linkeri care conțin peptide. Se poate alege un linker care este, de exemplu, susceptibil la scindare cu pH scăzut în compartimentul lizozomal sau susceptibil la scindare prin proteaze.

    De obicei, compusul chimic este un compus chimic terapeutic.

    Așa cum este utilizat aici, termenul "compus chimic terapeutic" se referă la orice compus chimic care poate fi administrat unui pacient pentru a produce un efect terapeutic sau de diagnostic benefic, deși se leagă și / sau modifică funcția unei molecule țintă biologice la pacient. Molecula țintă poate fi o moleculă țintă endogenă codificată de genomul pacientului (de exemplu, o enzimă, receptor, factor de creștere, citokină codificată de genomul pacientului) sau o moleculă țintă exogenă codificată de genomul unui agent patogen (de exemplu, o enzimă codificată de genomul unui virus, bacterie, ciupercă, nematod sau alt agent patogen).

    De obicei, compușii chimici terapeutici includ, dar nu se limitează la agenți imunosupresori (de exemplu, ciclosporină A, rapamicină, FK506, prednison), agenți antivirali (aciclovir, ganciclovir, indinavir), antibiotice (penicilină, miociclină, tetraciclină), agenți antiinflamatori ( aspirină, ibuprofen, prednison), citotoxine sau agenți citotoxici (de exemplu, paclitaxel, citochalasin B, gramicidin D, bromură de etidiu, emetină, mitomicină C, etopozid, tenoposid, vincristină, vinblastină, colchicină, doxorubicin, diororicicină, diorubicin , actinomicină D, 1-dihidrotestosteron, glucocorticoizi, procaină, tetracaină, lidocaină, propranolol, puromicină și analogi sau omologi ai oricăruia dintre agenții anteriori. , 5-fluorouracil decarbazină), agenți alchilanți (de exemplu, mechloretamină, tioepaclorambucil, CC-1065, melfalan, carmustină (BSNU), lomustină (C CNU), ciclofosfamidă, busulfan, dibromomannitol, streptozotocină, mitomicină C și cis-diclorodiamină platină (II) (DDP) cisplatină), antracicline (e. g., daunorubicină (fostă daunomicină) și doxorubicină), antibiotice (de exemplu, dactinomicină (fostă actinomicină), bleomicină, mitramicină și antramicină (AMC)), radionuclizi (de exemplu, iod-125, -126) itriu (de exemplu, ytt 90, -91) și praseodim (de exemplu, praseodim-144, -145) și inhibitori de protează (de exemplu, inhibitori ai metaloproteinazelor matrice).

    Într-o variantă, compusul chimic terapeutic include, dar nu se limitează la, agenți analgezici, inclusiv narcotice (de exemplu, codeină, nalmefenă, naloxonă, fentanil, meperidină, morfină, tramadol, propoxifen, oxicodonă, metadonă, nalbufină), agenți antiinflamatori nesteroidieni ( de exemplu, indometacină, ketorolac, artrotec, ibuprofen, naproxen, salicilat, celecoxib, rofecoxib), acetaminofen, capsaicină și ziconotidă.

    Într-o variantă particulară, compusul chimic terapeutic este un acid nucleic terapeutic, cum ar fi acizii nucleici antisens și ARNi.


    REZULTATE

    Exprimarea mutanților AE1 în celulele HEK-293

    Un panou de mutanți cu tunel simplu și dublu la poziții echivalente (Arg 283 și Glu 85 Fig. 1) față de cele (Arg 298 și Glu 91) conservate în NBCe1 uman (Fig. 1) au fost preparate în AE1 uman și exprimate în HEK-293 celule. O etichetă HA a fost proiectată în a treia buclă extracelulară pentru a facilita detectarea proteinei prin imunoblotare și prin imunofluorescență. AE1 exprimată în celule HEK-293 migrează pe geluri SDS-poliacrilamidă ca o singură bandă predominantă cu o masă moleculară de 95 kDa cu cantități mici de benzi superioare (Fig. 2, banda 1). Experimentele anterioare de deglicozilare enzimatică (41) au arătat că benzile superioare conțineau oligozaharide complexe, iar banda inferioară principală conținea oligozaharide mari cu manoză. Mutația single-ului N-sitiu de glicozilare în AE1 (N642D) a produs o singură bandă care a funcționat ușor mai repede decât forma inferioară cu manoză ridicată, confirmând prezența Noligozaharidă legată pe AE1 exprimată în celule HEK (Fig. 2, banda 9). Deși AE1 exprimat în celulele HEK-293 conține în principal oligozaharidă cu manoză bogată, aproximativ o treime din această formă, precum și forma complexă este prezentă la suprafața celulei, restul de două treimi fiind localizate în ER (11).

    Analiza imunoblot a expresiei totale a mutanților tunelului AE1 uman marcați HA în celulele HEK-293 transfectate. Celulele au fost cultivate timp de 48 de ore, recoltate și lizate în PBS cu 1% C12E8. Proteinele din extractele de detergent cu celule întregi au fost rezolvate prin electroforeză pe gel SDS, transferate în nitroceluloză și testate cu anticorp anti-HA de șoarece pentru a detecta AE1 marcat. A, imunoblot care arată expresia totală a AE1 și a mutanților. Benzi 1 și # x0201314 corespund AE1, E85A, E85R, R283A, R283E, R383S, E85R / R283E, AE1-His și N642D-His (panoul din stânga) și la AE1, kAE1, mdAE1, E681Q și P868L (panoul din dreapta). The cercuri umplute reprezintă AE1 cu oligozaharide complexe și cercuri deschise reprezintă AE1 cu oligozaharidă bogată în manoză. Pozițiile de migrare ale markerilor de masă moleculară sunt prezentate în kDa. B, cuantificarea nivelurilor totale de expresie ale mutanților AE1 normalizate la expresia GAPDH din trei experimente de transfecție independente. Barele de erori reprezinta S.D.

    Analiza imunoblotă a extractelor de detergent de celule întregi de celule HEK-293 transfectate a arătat că nivelurile de expresie ale tuturor mutanților tunelului erau comparabile cu AE1 de tip sălbatic (Fig. 2, benzi 2 & # x020137). De asemenea, am exprimat kAE1 care are un domeniu citosolic modificat (reziduuri 66 & # x02013356) mdAE1 (reziduuri 361 & # x02013911) care nu are întregul domeniu citosolic și doi mutanți suplimentari, E681Q care are o activitate de transport anionic scăzută (42, 43) și P868L ( Banda 3 transport mare) care are o activitate mare de transport anionic în celulele roșii (44, 45). Nivelurile de expresie ale kAE1 (Fig. 2, banda 11) și AE1 cu mutații funcționale în domeniul membranei (E681Q și P868L) au fost similare cu AE1 (Fig. 2, benzi 13 și 14). Astfel, nivelul activității de transport intrinsec al AE1 nu afectează nivelul de expresie al proteinei într-o mare măsură. Deși comparația directă a nivelurilor de expresie ale mdAE1 cu AE1 nu poate fi făcută din cauza dimensiunii diferite și a eficienței transferului în timpul imunoblotării, mdAE1 a fost, de asemenea, ușor detectată folosind anticorpul anti-HA (Fig. 2, banda 12). Rezultatele combinate pentru mai multe (n = 3) transfecțiile independente normalizate la GAPDH sunt rezumate în Fig. 2 B și Tabelul 1. Nivelurile normale de expresie pentru toți mutanții tunel arată că mutațiile introduse în domeniul citosolic nu au determinat AE1 să se plieze greșit și să fie vizate pentru degradare atunci când sunt exprimate în celulele HEK.

    TABELUL 1

    Expresia funcțională a mutanților AE1 etichetați HA în celulele HEK-293

    Eticheta HA a fost inserată în a treia buclă extracelulară a AE1 pentru a facilita detectarea pe imunobloti și la suprafața celulei celulelor HEK-293 intacte transfectate. ND, pRTA nedeterminată, acidoză tubulară renală proximală.

    ConstruiNiveluri relative de expresieExpresia suprafeței celulare A (+ / & # x02212)Expresia suprafeței celulare bActivitate relativă de transport cComentarii
    % %%
    AE1(100)+42 & # x000b1 5(100)Control etichetat HA
    E85A97 și # x000b1 12+58 & # x000b1 6122 & # x000b1 17Arg 283 - reziduu de interacțiune
    E85R111 & # x000b1 34+50 & # x000b1 3114 & # x000b1 12Inversarea taxei
    R283A113 & # x000b1 24+31 & # x000b1 2114 & # x000b1 1Glu 85 - reziduuri de interacțiune
    R283E130 & # x000b1 37+49 & # x000b1 1141 & # x000b1 15Inversarea taxei
    R283S129 & # x000b1 13+42 & # x000b1 3120 & # x000b1 16mutant echivalent pRTA
    E85R / R283E109 & # x000b1 16+57 & # x000b1 1131 & # x000b1 12Mutant cu inversare dublă
    kAE1163 & # x000b1 20+NDNDDomeniu citosolic trunchiat
    mdAE188 & # x000b1 13+47 & # x000b1 2118 & # x000b1 14Nu există domeniu citosolic
    E681Q84 & # x000b1 28+40 & # x000b1 418 & # x000b1 3Mutant cu transport redus
    P868L114 & # x000b1 18+38 & # x000b1 1111 & # x000b1 11Mutant de mare transport
    AE1SAOND& # x02212NDNDInactiv, reținut în ER
    N642D-His97 și # x000b1 6+NDNDN-Mutant de glicozilare
    AE1 (neetichetat)ND+40 & # x000b1 1123 & # x000b1 13Fără etichetă HA

    A Determinat prin detectarea prin imunofluorescență a etichetei HA în celulele intacte.

    b Determinat prin biotinilarea suprafeței celulare.

    c Corectat pentru activitatea de fundal a vectorului de control și normalizat pentru cantitatea de AE1 la suprafața celulei.

    Deoparte, kAE1 și mai mult mdAE1 a prezentat o proporție mai mare de oligozaharide complexe comparativ cu AE1 de lungime completă (& # x0223c50 și 75% pentru kAE1 și, respectiv, mdAE1, impotriva 18% pentru AE1) atunci când este exprimat în celule HEK (Fig. 2, banda 10 versus benzile 11 și 12). Modul în care modificările domeniului citosolic afectează procesarea oligozaharidelor de pe partea opusă a membranei necesită investigații suplimentare. Studiile anterioare au indicat că poziția lanțului oligozaharidic pe diferite bucle extracelulare ale AE1 afectează procesarea acestuia (41).

    Imunolocalizarea mutanților AE1

    Am examinat apoi localizarea celulară a mutanților tunelului folosind colorarea imunofluorescentă și microscopia confocală pentru a determina dacă mutația a afectat traficul de AE1 către suprafața celulei (Fig. 3). AE1 HA-etichetat în bucla extracelulară 3 a fost localizat la suprafața celulei în celule intacte (verde). Celulele au fost apoi permeabilizate și s-a detectat populația totală de AE1 (roșu). AE1 a arătat o colorare predominantă a suprafeței celulare (galben corespunde suprapunerii de verde și roșu) în celulele HEK-293 transfectate așa cum s-a observat anterior (11) la fel ca toți mutanții tunel și mdAE1. AE1 și mutanții tunel au prezentat, de asemenea, colorare intracelulară (roșu) care a co-localizat cu calnexin, un marker ER (nu este prezentat). În mod similar, kAE1 și mutanții E681Q și P868L au arătat, de asemenea, expresia suprafeței celulare, în timp ce mutantul de deleție AE1SAO a fost localizat în întregime intracelular în ER, așa cum sa raportat anterior (46). Astfel, introducerea mutațiilor tunelului în domeniul citosolic al AE1 nu împiedică exprimarea suprafeței celulare a acestora. Într-adevăr, mdAE1 a fost localizat și la suprafața celulei, arătând că domeniul citosolic nu este necesar pentru traficul de AE1 către membrana plasmatică.

    Localizarea mutanților AE1 umani în celulele HEK-293 transfectate utilizând imunofluorescență și microscopie confocală. Toate construcțiile aveau un epitop HA inserat în a treia buclă extracelulară pentru a permite detectarea expresiei suprafeței celulare în celulele intacte. Celulele fixe și nepermeabilizate au fost incubate cu anticorp anti-HA de șoarece urmat de anticorp anti-mouse conjugat cu Fluor Alexa 488 (verde) pentru a detecta suprafața celulei AE1. Celulele spălate au fost apoi permeabilizate cu detergent și incubate cu anticorp anti-HA de șoarece urmat de Cy3 anti-șoarece (roșu) pentru a detecta expresia AE1 totală. Galben este suprapunerea verde și roșu și reprezintă AE1 găsit la suprafața celulei. Calnexin, un marker pentru ER, a fost detectat folosind un anticorp anti-calnexin de iepure urmat de IgG-Cy5 anti-iepure (neprezentat). Rețineți că toți mutanții, cu excepția AE1SAO, care se găsește exclusiv în ER, au fost prezenți la suprafața celulei (galben), precum și în ER (roșu).

    Activitatea de transport a bicarbonatului mutanților AE1

    Activitățile de transport anionic ale mutanților tunel au fost testate în celule HEK-293 transfectate încărcate cu 2 & # x02032,7 & # x02032-bis (2-carboxietil) -5- (și -6-) carboxifluoresceină, un colorant fluorescent sensibil la pH ( Fig. 4). Celulele echilibrate în mediu care conțin bicarbonat și clorură au fost mutate în mediu fără cloruri, ceea ce a indus ieșirea clorurii mediată de AE1 din celule în schimbul bicarbonatului, ducând la alcalinizarea citosolului. Reeditarea mediului care conține clorură a dus la eflux de bicarbonat în schimbul clorurii și acidificării citosolului (32, 47). Celulele HEK-293 transfectate cu vector gol (pcDNA3) au avut puțină activitate de schimb clorură / bicarbonat detectabilă, în timp ce AE1 de tip sălbatic (WT) AE1 a avut activitate robustă (Fig. 4 A). Mutantul R283S a avut o activitate de transport similară cu AE1 de tip sălbatic. Mutantul E681Q a fost afectat în transport, dar a avut activitate reziduală deasupra controlului vector, arătând că nu a fost complet inactiv așa cum sa determinat prin această analiză în celulele HEK.

    Activitatea de transport anionică a mutanților AE1 cu etichetă HA umană în celulele HEK-293 transfectate. A, urmele testului de transport care arată activitatea AE1, R263S, E681Q și controlul vector (pcDNA3). B, grafic cu bare care prezintă activitatea de transport a anionilor diferiților mutanți AE1 etichetați HA față de AE1-HA, care este setată la 100%. Rezultatele sunt media a trei sau mai multe teste efectuate pe loturi separate de celule transfectate. Activitatea de transport a fost corectată pentru activitatea de fond găsită în celulele HEK-293 și normalizată în raport cu expresia suprafeței celulare determinată de teste de biotinilare. Doar mutantul E681Q a prezentat o semnificație statistică (p & # x0003c 0.01) scăderea activității de transport față de AE1. Barele de erori reprezinta S.D.

    Rezultatele a trei teste de transport independente ale grupului de mutanți corectate pentru activitatea de transport de fundal a controlului vectorului și normalizate la nivelurile de expresie a suprafeței celulare, determinate de testele de biotinilare sunt prezentate în Fig. 4 B și sunt rezumate în Tabelul 1. Toți mutanții tunelului au prezentat niveluri de expresie a suprafeței celulare și activități de transport ale anionului celular întreg comparabile cu AE1 de tip sălbatic (Tabelul 1).AE1 R283S, conținând mutația în poziția omoloagă care provoacă mutația proximală a acidozei tubulare renale în NBCe1, a avut o activitate de transport similară cu AE1. Astfel, acest reziduu de arginină nu joacă un rol esențial în procesul de translocare a anionilor de către AE1. Mutanții E85A și E85R au prezentat, de asemenea, activitate normală de transport, sugerând că acest reziduu nu este, de asemenea, esențial pentru procesul de transport în AE1. Mutarea dublă & # x0201charge & # x0201d mutant (E85R / R283E) a arătat și activitate de transport normală. Exprimarea domeniului de membrană al AE1 în celulele HEK-293 a dus la un nivel ridicat de activitate de transport, confirmând că domeniul citosolic nu este necesar pentru activitatea de transport (25). AE1 cu o etichetă externă HA a fost utilizată ca control, deoarece mutanții tunel conțineau, de asemenea, eticheta HA și au fost derivați din această construcție. AE1 marcat cu HA a avut activitate de transport similară comparativ cu AE1 nemarcat în doi vectori diferiți, pcDNA3 (AE1WT) (11) și pJRC9 (JRAE1) (47) (Tabelul 1). Prin urmare, introducerea etichetei extracelulare HA în bucla extracelulară 3 nu afectează expresia funcțională a AE1.

    Datele testului de transport arată că niciunul dintre mutanții tunelului nu a fost afectat în activitatea de transport la nivelul mutantului E681Q (Tabelul 1). Glu 681 s-a arătat anterior că este necesar pentru schimbul de clorură / bicarbonat (42, 43, 48, 49) și a fost utilizat ca control defect la transport. Mutantul E681Q a avut o activitate de transport foarte scăzută (18% impotriva AE1-HA) în celulele transfectate, dar puțin peste controlul vectorului gol, indicând o anumită activitate de transport reziduală. De asemenea, am testat P868L, care se raportează că are o activitate de transport îmbunătățită de 2 ori # x020133 de ori în celulele roșii din sânge (45). Cu toate acestea, acest mutant a avut un nivel normal de activitate de transport atunci când a fost testat în celulele HEK-293 transfectate. Acest lucru sugerează că activitatea de transport a acestui mutant este dependentă de contextul său celular. Celulele HEK-293, de exemplu, nu exprimă proteine ​​ale celulelor roșii, inclusiv glicoforină A, despre care se știe că influențează activitatea de transport a AE1 (50 & # x0201352). Testele de transport arată în mod clar că mutația reziduului Arg 283 sau Glu 85 în domeniul citosolic nu afectează activitatea de transport anionică a AE1 atunci când este exprimată în celule HEK-293.

    Structura cristalină a cd & # x0039454AE1

    În 2000, o structură cristalină a cdAE1 obținută la rezoluția 2,6 - & # x0212b a fost raportată de Low și colegii săi (24). A dezvăluit natura dimerică a cdAE1 și multe dintre trăsăturile sale structurale importante. Cristalele au fost produse din proteine ​​recombinante la pH scăzut (4,8) folosind ca precipitant sulfat de amoniu (53, 54). Domeniul citosolic al AE1 suferă modificări structurale dramatice trecând de la o structură compactă la pH scăzut la o structură mai deschisă și asimetrică la pH neutru și alcalin (26, 27, 53, 55), lăsând deschisă întrebarea dacă structura obținută sub acid condițiile diferă de structura la pH neutru. Pentru a obține o structură cristalină a cdAE1 în condiții mai fiziologice, am eliminat regiunea N-terminală acidă intrinsec dezordonată (reziduurile 1 și # x0201354) și regiunea linkerului C-terminal (reziduurile 357 și # x02013379) care nu sunt vizibile în structura cristalină originală. Am reușit să producem o nouă formă cristalină de cd & # x0039454AE1 (reziduuri 55 & # x02013356) folosind PEG ca precipitant la pH 6,5 care a difractat la 2,1 & # x0212b (Fig. 5 și Tabelul suplimentar 1). Grupul spațial a fost P212121 cu doi monomeri în unitatea asimetrică (A, 69,9 și # x0212b b, 80,7 și # x0212b c, 104.3 & # x0212b cu & # x003b1, & # x003b2, & # x003b3 = 90 & # x000b0).

    Structura cristalină a cd & # x0039454AE1 la pH 6,5. A, diagramă panglică a cd & # x0039454AE1 care arată structura dimerică cu lanțul A în portocale și lanțul P în teal. B, comparația structurii pH 6,5 determinată aici (colorată portocale și teal) cu structura cristalină anterioară cu pH 4,8 (Protein Data Bank cod 1HYN colorat maro și verde). C, vedere mărită a regiunii tunelului cu reziduuri importante etichetate. D, un 2Fo & # x02212 Fc hartă a densității electronilor care arată rețeaua legată de hidrogen a Arg 283 și Glu 85. aa, aminoacizi.

    La fel ca cdAE1, cd & # x0039454AE1 este un dimer constând dintr-un domeniu de interacțiune N-terminal (reziduuri 55 & # x02013313) și brațe de dimerizare C-terminale (reziduuri 314 & # x02013347) implicate în schimbarea domeniului. Rezultatele indică faptul că extensia acidă N-terminală are un efect redus asupra structurii de bază a cdAE1, în concordanță cu primele 54 de reziduuri care funcționează ca regiune proprie independentă dezordonată intrinsec implicată în interacțiunile proteinelor cu proteinele citosolice precum hemoglobina (56). Există diferențe subtile între cei doi monomeri din dimer care se pot datora împachetării cristalelor. În lanțurile A și P, primele reziduuri vizibile în densitatea electronilor au fost Val 57 și respectiv Lys 56 (Fig. 5 A). În lanțul A, reziduurile ar putea fi încadrate în densitatea electronilor la Ser 350, dar în lanțul P, reziduurile ar putea fi potrivite numai la Gln 348. În lanțul A, există o regiune dezordonată de la Ser 181 la Asp 183, rezultând pierderea de & # x003b27 (reziduuri 182 & # x02013185), parte a unei bucle de ac de păr care leagă ankirina (57). O altă diferență se află într-o regiune de buclă (reziduuri 202 & # x02013211) văzută în structura pH 4,8, care este mai dezordonată în structura pH 6,5, extinzându-se mai departe de reziduul Glu 202 până la Asp 218, ducând la pierderea unei elice scurte (& # x003b16 reziduuri 212 & # x02013220) vizibile la pH 4,8. Noua structură cristalină indică faptul că regiunile cdAE1 implicate în interacțiunile proteice sunt dinamice și pot presupune stări conformaționale diferite la valori diferite ale pH-ului, probabil pliabile la legarea proteinelor. Per ansamblu, structura este foarte similară cu reziduurile 55 & # x02013356 cu structura (codul 1HYN al Protein Data Bank) publicată pentru prima dată de Low și colegii (24) (deviația pătrată medie a rădăcinii a fost de 1,14 & # x0212b peste 530 de reziduuri aliniate folosind SSM în Coot), arătând că există un acord bun între structurile proteice de bază obținute la pH 4,8 și 6,5 în două condiții diferite de cristalizare, forme cristaline și grupuri spațiale (Fig. 5 B). Diferențele în structura regiunilor buclei implicate în interacțiunile proteice sunt importante deoarece unele regiuni pliate și îngropate la pH scăzut devin desfăcute și accesibile la pH fiziologic.

    Folosind structura cristalină de pH 6,5, regiunea posibilă a tunelului în jurul Arg 283 este ilustrată în Fig. 5, C și D. Arg 283 este situat în mijlocul & # x003b17 (reziduuri 278 & # x02013290). După cum a indicat Chang și colab. (23), Arg 283 se află într-o regiune ocluză, inaccesibilă a solventului, a proteinei. Există o legătură de hidrogen între azotul cu lanț lateral al Arg 283 și oxigenul din lanțul lateral al Glu 85 (2,74 & # x0212b), care este situat aproape de începutul lui & # x003b23 (reziduuri 84 & # x0201388). La rândul său, lanțul lateral carbonilic al Glu 85 face o legătură de hidrogen la NH2 din Arg 283. În plus, Arg 283 produce, de asemenea, două legături de hidrogen la carbonilul din lanțul principal al lui His 101. Arg 283 face, de asemenea, o legătură de hidrogen cu gruparea hidroxil de pe Glu 280, situată la trei reziduuri proximale pe aceeași parte a helixului 7. Glu 85 face la rândul său legături de hidrogen la Asn 87 și Ser 100. Glu 86 face o legătură de hidrogen la Pro 213 aproape de începutul segmentului elicoidal & # x003b16 (reziduuri 212 & # x02013220), care este destabilizat la pH 6,5. O mutație a Arg 283 la Ser ar duce la întreruperea acestei rețele elaborate de legare H și ar putea destabiliza proteina. Într-adevăr, toate încercările de cristalizare a mutanților R283S sau R283A în condiții similare cu proteina de tip sălbatic au eșuat, indicând o structură proteică perturbată. Prin urmare, am efectuat o serie de studii biofizice pentru a determina efectul mutațiilor asupra stabilității domeniului citosolic izolat.

    Sensibilitatea mutanților cd & # x0039454AE1 în tunel la pH și denaturarea ureei

    CdAE1 suferă modificări dramatice cu pH-ul, trecând de la o structură compactă în condiții acide la o structură mai extinsă și deschisă în condiții neutre și alcaline (24, 26, 55, 58). Titrarea cd & # x0039454AE1 a arătat o creștere tipică a fluorescenței intrinseci, trecând de la pH acid la alcalin, rezultând din stingerea reziduurilor de triptofan grupate (Fig. 6 A). Mutantul R283S a suferit o tranziție similară, dar a avut o fluorescență intrinsecă mai mare la pH scăzut decât proteina de tip sălbatic. Această caracteristică este în concordanță cu o structură mai deschisă la pH scăzut, așa cum sa observat și pentru cdAE1 renală (35). Un efect similar a fost observat pentru ceilalți mutanți cu o fluorescență intrinsecă mai mare la pH scăzut decât tipul sălbatic și o creștere a fluorescenței la pH alcalin (Fig. 1 suplimentară). Proteina cd & # x0039454AE1 de tip sălbatic și mutantul R283S au avut spectre CD identice (Fig. 6 B), indicând faptul că această mutație punctuală nu a indus nicio modificare majoră în structura secundară a domeniului.

    Efectul mutației R283S asupra proprietăților biofizice ale cd & # x0039454AE1. A, efectul pH-ului asupra fluorescenței intrinseci a cd & # x0039454AE1 și a mutantului R283S. Ambele proteine ​​au prezentat o creștere a fluorescenței la pH alcalin, mutantul prezentând o fluorescență mai mare la valori scăzute ale pH-ului, în concordanță cu o structură mai deschisă. B, spectrele de dicroism circular (CD) ale cdD54AE1 și ale mutantului R283S în 100 m m NaCI, 20 m m Tris-HCI, pH 8,0. C, profiluri de filtrare pe gel ale cd & # x0039454AE1 și ale mutantului R283S. Probele au fost aplicate pe o coloană S200 HiLoad 16/60 echilibrată în 100 m m NaCI, 20 m m Tris-HCI, pH 8,0. Vârful major corespunde formei dimerice a proteinelor. AU, unități de absorbanță.

    Sensibilitatea mutanților de tip sălbatic și tunel de cd & # x0039454AE1 la denaturarea ureei a fost examinată la diferite valori ale pH-ului (Fig. 2 suplimentară). La pH 10,5 când cd & # x0039454AE1 are o conformație extinsă, ureea a dus la desfășurarea proteinelor cu o scădere a fluorescenței intrinseci la concentrații de uree peste 3 m. Fluorescența intrinsecă a mutanților tunel a avut un model similar, deși a fost observată o scădere a fluorescenței intrinseci pentru toți mutanții cu 3 m uree, indicând o stabilitate ușor mai mică. La pH 8,5, cd & # x0039454AE1 a prezentat o creștere inițială a fluorescenței intrinseci, atingând un vârf între 2 și 3 m uree și apoi scăzând la concentrații mai mari de uree. Creșterea se datorează stingerii triptofanului pe măsură ce domeniul începe să se desfășoare, în timp ce scăderea se datorează expunerii triptofanilor la solvent pe măsură ce se desfășoară desfășurarea. Mutanții au prezentat un model similar cu o creștere a fluorescenței intrinseci până la 2 m uree urmată de o scădere. La pH 6,5, creșterea fluorescenței intrinseci pentru tipul sălbatic și mutanții tunel s-a produs la concentrații mai mari de uree (5 m), în concordanță cu o structură mai stabilă la pH scăzut. S-a observat un efect intermediar la pH 7,5. Aceste studii de denaturare susțin opinia că mutațiile tunelului au afectat stabilitatea domeniului citosolic.

    Cd & # x0039454AE1 (greutate moleculară calculată cu monomer, 34.739) eluat ca un vârf major pe o coloană de filtrare cu gel S200 16/600 cu o masă moleculară aparentă de 122 kDa cu o cantitate mai mică de un vârf cu greutate moleculară mai mare (Fig. 6 C). Vârful principal corespunde unui dimer, greutatea moleculară aparentă mai mare se datorează naturii asimetrice a dimerului (55). Mutantul R283S (greutate moleculară calculată cu monomer, 34.669) eluat ca un vârf major cu o masă moleculară aparentă ușor mai mare de 143 kDa, în concordanță cu o structură mai asimetrică, precum și un vârf anterior atribuit unui tetramer. Măsurătorile de împrăștiere a luminii (Fig. 3 suplimentară) utilizând un instrument de împrăștiere a luminii cu unghi redus Malvern Viscotec conectat la o coloană S200 10/300 a arătat că dimerul de tip sălbatic cd & # x0039454AE1 avea o masă moleculară de 73,5 kDa și o rază de hidratare de 3,6 nm. Dimerul R283S avea o masă moleculară de 71,4 kDa cu o rază de hidratare mai mare de 4,2 nm, indicând o structură mai asimetrică. Dimerul mutant a avut tendința de a forma tetrameri la recromatografie, formând un nou vârf cu o masă moleculară de 159 kDa și o rază de hidratare de 6,7 nm cu cantități mici de oligomeri mai mari eluând la volumul gol, în timp ce proteina de tip sălbatic a păstrat o stabilitate structură oligomerică dimerică. Aceste rezultate arată că mutația R283S a avut un efect destabilizator asupra cd & # x0039454AE1, rezultând o proteină mai asimetrică care este predispusă la agregare, cauza probabilă a incapacității noastre de a cristaliza mutanții.


    Abstract

    OxlT, schimbătorul de oxalat / formiat al Oxigenele formigene, este membru al supra-familiei facilitatorilor majori de transportatori. În lucrarea de față, s-a constatat că substratul (oxalat) îmbunătățește reactivitatea mutantului cisteină S336C la capătul citoplasmatic al helixului 11 la metanetiosulfonat etil carboxilat. În plus, se constată că S336C se leagă spontan de S143C în TM5 în membranele native sau reconstituite în condiții care susțin transportul. Măsurătorile EPR de undă continuă sunt în concordanță cu acest rezultat și indică faptul că pozițiile 143 și 336 se află în imediata apropiere în prezența substratului. Aceste două reziduuri sunt localizate în motive interacționate cu helix, asemănătoare cu GxxxG (G140LASG144 și S336DIFG340) la polii citoplasmatici ai TM5 și TM11. Măsurătorile EPR în impulsuri au fost utilizate pentru a determina distanțele și distribuțiile distanței de-a lungul capetelor citoplasmatice sau periplasmatice ale OxlT și au fost comparate cu predicțiile unui model de omologie în interior deschis. Datele indică faptul că o populație semnificativă de transportor se află într-o configurație deschisă în exterior în prezența substratului, totuși, fiecare capăt al transportorului prezintă o eterogenitate conformațională semnificativă, în care sunt prezente atât configurații în interiorul deschis, cât și în exteriorul deschis. Aceste date indică faptul că TM5 și TM11, care fac parte din calea de transport, se apropie tranzitoriu în timpul transportului și că există un echilibru conformațional între stările interioare-deschise și exterioare-deschise ale OxlT în prezența substratului.


    Concluzii și direcții viitoare

    Dezvoltarea platformelor vegetale dedicate producției de PMP glicozilate pentru aplicare parenterală la om necesită luarea în considerare a ambelor N- și O-glicoepitopi specifici glicanilor. Eforturile continue de a optimiza compoziția glicanului pentru o imunogenitate mai mică sunt concentrate în prezent exclusiv pe N-glicanii. Într-adevăr, s-a acordat foarte puțină atenție până acum prezenței specifice plantelor O-glicanii pe PMP, deși multe proteine ​​terapeutice produse deja în sistemele de expresie a plantelor sunt candidați foarte buni pentru Pro hidroxilare și Hyp O-glicozilare, după cum este ilustrat în special cu IgA umană produsă în porumb (Karnoup și colab., 2005 ).

    Inginerie N-glicozilarea în plante ar putea îmbunătăți eficiența PMP, nu numai prin reducerea instalației N-imunogenitatea glicanului la om, dar și prin furnizarea de sisteme de exprimare a plantelor dedicate producției de glicovarianți proteici terapeutici greu produși cu costuri reduse în celulele de mamifere cultivate. De exemplu, anticorpi cu tip high-Man N-glicanii, care prezintă promisiuni pentru terapia cancerului datorită eliminării rapide a acestora în țesuturile necanceroase in vivo, pot fi obținute cu ușurință în sistemele de plante utilizând retenția de proteine ​​în deranjamentul ER sau GNTI, oferind astfel o alternativă posibilă la celulele CHO mutante Lec 1 (Wright și Morrison, 1998). O altă ilustrație pentru potențialul celulelor vegetale în producția de anticorpi se referă la așa-numitul proces de citotoxicitate celulară dependentă de anticorpi (ADCC), un atac litic asupra celulelor vizate de anticorpi considerate ca fiind o funcție majoră a anticorpilor terapeutici „antitumorali”. Activitatea ADCC depinde de prezența și structura N-glicanii în poziția Asn-297 pe lanțurile grele, așa cum este ilustrat de activitatea ADCC îmbunătățită a glicoformelor de anticorpi lipsite de α1,6 fucoză în N-lanturi glican (Scuturi și colab., 2002 Shinkawa și colab., 2003 Niwa și colab., 2005 Ferrara și colab., 2006) și dezvoltarea recentă a unei linii de celule stabile CHO glicoinginerate de mare producție pentru producția pe scară largă de anticorpi terapeutici non-fucosilați (Kanda și colab., 2006). Interesant, lipsa de fucoză legată de α1,3 pe N-glicanii unui anticorp produs în rațe sau Arabidopsis după eliminarea α1,3 FucT are același efect pozitiv asupra activității ADCC ca îndepărtarea fucozei α1,6 pe un anticorp produs în linia celulară CHO cu deficiență de fucoză (Cox și colab., 2006 Schähs și colab., 2007 ).

    De asemenea, este de remarcat faptul că disponibilitatea plantelor glicoinginere nu este necesară pentru toate PMP. De exemplu, N-glicanii pe glucocerebrosidază umană de origine vegetală sunt potriviți pentru terapia de substituție enzimatică a bolii Gaucher, fără a fi nevoie de in vitro procesarea glicanului așa cum este descris pentru glucocerebrosidaza produsă în celulele CHO (Shaaltiel și colab., 2007). Specific plantelor N-glicozilarea ar putea reprezenta, de asemenea, un avantaj semnificativ în unele cazuri, în special pentru antigenele vaccinale recombinate. Promisiunea vaccinurilor recombinante fabricate din plante a fost amplu demonstrată în ultimii ani, cu peste 200 de lucrări care descriu producția de vaccinuri și alergeni în plante (Faye și Gomord, 2010) și dezvoltarea cu succes a unui vaccin împotriva virusului bolii Newcastle pentru păsări de curte. produs în celule de tutun cultivate în suspensie, înregistrate și aprobate de Departamentul Agriculturii al SUA în ianuarie 2006 (Vermij și Waltz, 2006). Pe lângă avantajele lor recunoscute pentru producția rapidă și cu randament ridicat de vaccinuri administrate parenteral (a se vedea McCormick și colab., 2008 D’Aoust și colab., 2009 D’Aoust și colab., 2010 pentru ilustrații recente), este posibil ca sistemele de exprimare a plantelor să contribuie la o utilizare mai largă a vaccinurilor orale ieftine în viitor (vezi Mestecky și colab., 2008 și Rybicki, 2009 pentru recenzii recente). În acest scop, au fost identificate strategii specifice plantelor pentru a crește stabilitatea la căldură a antigenului și rezistența la digestia enzimatică în tractul gastrointestinal, inclusiv încorporarea proteinelor recombinante în particule biodegradabile, cum ar fi lipidele sau corpurile de proteine ​​naturale sau artificiale (Nochi și colab., 2007 http://www.sembiosys.com și http://www.erabiotech.com). Mai mulți adjuvanți ai mucoasei au fost, de asemenea, investigați pentru a spori imunogenitatea și absorbția de antigene de origine vegetală de către intestin pentru vaccinarea orală sau căi alternative, cum ar fi intranazale. prin intermediul suprafețele mucoasei. Utilizarea plantei N-glicanii ca glicoadjuvanți și capacitatea lor de a lega receptorii Man la suprafața celulelor care prezintă antigen, totuși, nu a fost încă evaluată in vivo, deși rezultatele recente obținute cu o glucocerebrosidază umană produsă de plante au ilustrat capacitatea plantei N-glicanii pentru a lega acești receptori (Shaaltiel și colab., 2007).Încercările recente din laboratorul nostru s-au dovedit, de asemenea, promițătoare către dezvoltarea de glicoadjuvanți specifici plantelor pentru imunizarea cu vaccinuri mucoase fabricate din plante. Am observat în special că prezența plantei N-glicanii unui alergen recombinant ar putea reprezenta un avantaj în imunoterapia specifică sublinguală a bolilor alergice (Gomord, V., date nepub.). În ansamblu, aceste rezultate indică faptul că, pe lângă avantajele bine descrise pentru producția rapidă, ridicată, cu cost redus și fără contaminare a proteinelor farmaceutice, plantele apar acum ca un sistem puternic de expresie pentru producerea de glicovarianți proteici terapeutici care arată similar, sau chiar mai mare, activitate biologică decât omologii proteici exprimați în celule de mamifere cultivate.


    Priveste filmarea: Cum se leaga carligele de PESCUIT (Ianuarie 2022).