Informație

De ce repetă Alu formează structuri secundare?


Am făcut o mulțime de cercetări privind repetările Alu și modul în care acestea mediază expresia genei. Am citit următorul articol „Junk utile: ARN-uri Alu în transcriptomul uman”.

Și spune că repetițiile alu încorporate în 5'UTR fac o structură secundară stabilă care împiedică asamblarea subunităților ribozomale, blocând astfel procesul de traducere. Am citit diverse articole pentru a afla de ce repetă Alu din această structură secundară și de ce numai în 5'UTR și nu în 3'UTR. Dar nu am putut găsi un răspuns.


ARN monocatenar poate forma cu ușurință structuri secundare, un exemplu foarte important în acest sens sunt ARNt.

Dintr-o scurtă privire asupra articolului pe care l-ați citit, se pare că aceste Alu repetă funcționare similară cu riboswitch-urile din 5'-UTR. Ele pot forma structuri secundare care blochează inițierea traducerii, riboswitch-urile fac de obicei ascunzând secvența Shine-Dalgarno într-o spirală stabilă.

Acest tip de reglementare a traducerii poate funcționa în mod evident numai în 5'-UTR, deoarece acesta este locul de unde începe traducerea. 3'-UTR nu poate afecta traducerea în acest fel, deoarece traducerea începe de la celălalt capăt al ARNm.

Repetările Alu încă pot forma structuri secundare în 3'-UTR, iar articolul sugerează că acestea ar putea avea un efect asupra stabilității ARNm.


Transpozoni sau gene de sărituri: tipuri, structură, mecanism și funcții

Să facem un studiu aprofundat al transpozonilor sau genelor săritoare. După ce citiți acest articol, veți afla despre: 1. Introducere în transpozoni 2. Tipuri de transpozoni 3. Structura unui transpozon 4. Secvența țintă 5. Mecanismul de transpunere 6. Funcțiile transpozonilor 7. Formarea de gene noi și 8. Pseudogene.

Introducere în transpozoni:

Anterior, se credea că genele erau statice și aveau un locus definit și fixat. Cu toate acestea, mai multe tipuri de rearanjare și recombinare a genelor au ieșit la iveală recent. Segmente de ADN care pot sări către site-uri țintă din genom au fost descoperite pentru prima dată de Barbara Mc Clintock. Ea a descoperit că porumbul indian de porumb are știuleți cu sâmburi de diferite culori.

Potrivit ei, miezurile de culoare deschisă au fost cauzate de un segment de ADN care a sărit în genele care codifică miezurile pigmentate, inactivând astfel miezurile pigmentate. Aceste gene mobile se numesc transpozoni sau elemente transpozabile.

Transpozonii pot sări în interiorul genomului, afectând astfel expresia genelor. Ele sunt destul de diferite de schimburile reciproce sau omoloage de ADN. Mișcarea segmentelor ADN se numește transpunere.

Este o formă specifică de recombinare genetică care determină deplasarea anumitor elemente genetice de la un situs ADN la altul. Transpozonii introduși într-o genă duc la întreruperea funcției lor. Când sunt inserate în secvența reglatoare a genelor, ele provoacă schimbări în expresia genelor.

Transpozonii sunt prezenți în toate formele de viață. Acestea sunt principalele componente ale ADN-ului moderat repetitiv. La om mai mult de 50% genom este compus din elemente transpozabile.

Tipuri de transpozoni:

Transpunerea are loc prin două metode:

1. Transpunere simplă non-replicativă:

Aceasta implică excizia transposonului de la locația sa originală la noul situs ADN. Aceasta este, de asemenea, cunoscută transpunerea tăiată și lipită.

2. Transpunerea ADN-ului prin mecanism replicativ:

Segmentele transpozabile generează o copie nouă prin replicare. Prima copie rămâne la site-ul original și a doua copie se mută pe un site nou oriunde în genom.

Mișcarea către locul țintă necesită ruperea cromozomului la noul loc și introducerea transpozonului între cele două capete generate. Enzimele necesare pentru ruperea și re-aderarea cromozomului sunt prezente în transpozonul propriu-zis.

Structura unui transpozon:

Transpozonii sunt întinderi de ADN care au segmente de ADN repetate la ambele capete. Un transpozon constă dintr-o secvență centrală care are transpuse gena și gene suplimentare. Aceasta este flancată pe ambele părți de segmente ADN scurte repetate. Segmentele repetate pot fi repetări directe sau repetări inversate. Aceste repetări terminale ajută la identificarea transpozonilor.

Numărul de nucleotide repetate este inegal 5 sau 7 sau 9 nucleotide se datorează metodei sale de inserție la locul țintă.

Secvența țintă:

Site-ul în care este inserat un transposon se numește site țintă sau site destinatar. Înainte ca transpozonul să fie mutat în locul țintă, secvența țintă este duplicată.

Cele două exemplare formate se îndepărtează. Transpozonul este inserat între cele două copii ale secvențelor țintă.

Mecanismul de transpunere:

Enzima transpozază prezentă în transpozonul însuși produce scuturi sau tăieturi în fiecare fir al secvenței țintă. Secvența țintă este duplicată și două copii se îndepărtează pentru a face loc transpozonului din centru. Transpozonul se fixează apoi în cele două capete libere generate. Nisurile sunt sigilate de ligază și două fire devin continue.

Funcțiile transpozonilor:

Mutația cauzată de transpozoni:

Transpozonii sunt introduși în gene care le afectează funcția, provocând astfel întreruperea funcțiilor lor. Când sunt inserate în secvența reglatoare a genelor, ele provoacă schimbări în expresia lor. Ele sunt cea mai comună sursă de mutație. Transpozonii pot insera codoni stop, producând astfel proteine ​​trunchiate.

În drosofilă, majoritatea mutațiilor spontane sunt cauzate de transpozonii care sar într-o genă. Drosfila mutantă cu ochi albi este produsă de un element transpozabil inserat în genă, care produce în mod normal pigment roșu.

La ființele umane, transpozonii provoacă multe boli genetice. Transpozonii conduc la dezvoltarea sistemului imunitar funcțional la vertebrate.

La bacterii, elementele transpozabile sunt prezente pe ADN-ul cromozomial suplimentar numit plasmid. Elementele transpozabile de pe plasmide poartă gene pentru proteine ​​care anulează efectele medicamentelor antibacteriene și ale toxinelor.

Formarea de gene noi:

Cum produc celulele gene noi? De multe ori se face prin amestecarea exonului prin care unitățile funcționale ale două gene existente se recombină generând o nouă genă. Duplicarea exonului și divergența își joacă, de asemenea, rolul în formarea de gene noi.

Pseudogene:

Transpozonii introduc o mare flexibilitate a genomului. Uneori, genele duplicate și alte transpozoni nu reușesc să producă o genă funcțională și, prin urmare, devin

Transpozoni sau gene de sărituri:

preudogeni sau morți prin produse ale evoluției. Pseudogenele sunt frecvente în genomul mamiferelor și sunt incapabile să producă ARNm pentru traducere.


Structura beta

Structura beta: Catena beta paralelă și antiparalelă este mult mai extinsă decât helicele alfa (phi / psi de -57, -47), dar nu la fel de extinsă ca un lanț polipeptidic complet extins (cu unghiuri phi / psi de +/- 180). Foliile beta nu se lasă atât de extinse (paralele -119, +113 antiparalele, -139, +135) și pot fi imaginate ca foi fandate. Acestea pot fi vizualizate prin așezarea de benzi subțiri și pliate de hârtie, unul lângă altul, pentru a face o „foaie pliată” de hârtie. Fiecare bandă de hârtie poate fi reprezentată ca o singură suvită de peptide în care coloana vertebrală a peptidei face un zig-zag de-a lungul benzii, cu carbonii alfa care se află la pliurile pliurilor. Fiecare fir unic al foii beta poate fi reprezentat ca o helică dublă, adică o helică cu 2 reziduuri / tură. Aranjamentul fiecărui plan peptidic succesiv este plisat datorită naturii tetraedrice a alfa C. Legăturile H sunt interstrand, nu intrastrand ca în alfa helix.

Figura: fire paralele beta (imagine realizată cu Spartan)

Figura: Toroane beta antiparalele (imagine realizată cu Spartan)

Luați în considerare o catenă ca o coloană vertebrală continuă și contiguă de polipeptidă care se propagă într-o singură direcție. Prin urmare, folosind această definiție, o helică constă dintr-o singură catena, iar toate legăturile H se află în catena (sau intrastrandă). O foaie beta ar consta apoi din mai multe catene, deoarece fiecare „catena” este separată de alte „catene” de o întindere contiguă de aminoacizi care se îndoaie în proteină într-un mod care permite următoarea secțiune a coloanei vertebrale a peptidei, următoarea „cadrană”, la H -obligați cu primul & quotstrand & quot. Dar amintiți-vă, chiar și în acest caz, toate legăturile H care țin împreună structura alfa și beta sunt intramoleculare.

Într-o structură paralelă a foii beta, modelul optim de legătură H conduce la o structură mai puțin extinsă (phi / psi de -119, +113) decât aranjamentul optim al legăturilor H în structura antiparalelă (phi / psi de -139, + 135). De asemenea, legăturile H din foaia paralelă sunt îndoite semnificativ. (adică carbonil O pe o catena nu este exact opus amidei H pe catena adiacentă, așa cum este în foaia antiparalelă.) Prin urmare, catena beta antiparalelă este probabil mai stabilă, chiar dacă ambele se găsesc abundent în natură. Foile scurte paralele beta de 4 fire sau mai puțin nu sunt comune, ceea ce ar putea reflecta stabilitatea lor mai mică.

Lanțurile laterale din foaia beta sunt normale față de planul foii, extinzându-se din plan pe laturi alternative. Foliile paralele distribuie în mod caracteristic lanțurile laterale hidrofobe pe ambele părți ale foii, în timp ce foile antiparalele sunt de obicei aranjate cu toate reziduurile hidrofobe pe o parte. Acest lucru necesită o alternanță a lanțurilor laterale hidrofile și hidrofobe în secvența primară. Cearșafurile antiparalel se găsesc în mătase, cu cearșafurile paralele cu fibrele de mătase. Următoarea repetare se găsește în secvența primară: (Ser-Gly-Ala-Gly) n), cu Gly arătând de pe o față și Ser sau Ala de pe cealaltă.

Suvitele beta au tendința de a se răsuci în direcția mâinii drepte. Acest lucru duce la consecințe importante în modul în care sunt conectate firele beta. Suvitele paralele pot forma foi sau șeuri răsucite, precum și butoaie beta.

Figura: Foaie / șa Beta răsucite (imagine realizată cu VMD)

Figura: Beta Barrel (imagine realizată cu VMD)

  • în toroane paralele, conectivitatea cu mâna dreaptă este obișnuită.
  • într-o proteină cu fir paralel în registru și având în vedere răsucirea inerentă a standurilor, firele se aranjează într-un mod pentru a avea legăturile H întinse în mod egal la capetele lanțurilor, dând naștere unei forme de șa răsucite (structura superioară deasupra) .

Jmol: Foaie beta răsucită actualizată din Arabinose Binding Protein Jmol14 (Java) | JSMol (HTML5)

  • într-o proteină cu șuvițe paralele scoase din registru și având în vedere răsucirea inerentă a standurilor, șuvițele se aranjează într-un mod pentru a avea legăturile H întinse în mod egal la capetele lanțurilor, dând naștere unui butoi beta (structura inferioară deasupra) .

Jmol: Baril beta din trioză fosfat izomerază


7.3: Replicare procariotă

  • Contribuție de E. V. Wong
  • Editura Axolotl Academica (Biologie) la Editura Axolotl Academica

Replicarea ADN începe la originea replicării. Există o singură origine în procariote (în E coli, oriC) și se caracterizează prin matrice de secvențe repetate. Aceste secvențe înfășoară în jurul unei proteine ​​care leagă ADN-ul și, făcând acest lucru, exercită presiune asupra legăturilor H dintre firele de ADN, iar cromozomul începe să se dezarhiveze într-o zonă bogată în AT înfășurată în jurul acestei proteine. Amintiți-vă că perechile A-T sunt cu 33% mai slabe decât perechile G-C din cauza mai puține legături de hidrogen. Utilizarea unor întinderi de ADN bogate în AT ca puncte de separare a catenelor este o temă recurentă printr-o varietate de operații ADN. Separarea celor două catene este bidirecțională, iar polimerazele ADN vor acționa în ambele direcții pentru a termina procesul cât mai repede posibil. Viteza este importantă aici, deoarece în timp ce se întâmplă replicarea, ADN-ul este vulnerabil la rupere, iar majoritatea proceselor metabolice sunt închise pentru a dedica energia replicării. Chiar și în procariote, unde moleculele de ADN sunt ordine de mărime mai mici decât în ​​eucariote, dimensiunea moleculei de ADN atunci când este dezlegată din proteinele de ambalare protectoare o face extrem de susceptibilă la daune fizice doar din mișcările celulei.

Prima proteină de legare OriC, DnaA, se leagă de cutiile DnaA, care sunt 9 segmente de perechi de baze cu o secvență consensuală a TTATCCACA. OriC are cinci dintre aceste repetări și o proteină DnaA se leagă de fiecare dintre ele. HU și IHF sunt proteine ​​asemănătoare histonelor care se asociază cu DnaA și împreună îndoi acea parte a ADN-ului într-o buclă circulară, situându-l chiar peste cealaltă caracteristică majoră a oriC, repetările bogate în AT de 13 bp (GATCTNTTNTTTT). DnaA hidrolizează ATP și rupe legăturile H dintre catene în repetările 13mer, cunoscute și sub numele de topirea ADN-ului. Acest lucru permite complexe de DnaB [și DnaC, care este o proteină de încărcare care ajută la atașarea DnaB (6) la catena cu hidroliza însoțitoare a ATP. De asemenea, sunt recrutați încă cinci DnaA pentru a stabiliza bucla.] Pentru a se lega de fiecare regiune monocatenară a ADN-ului de pe laturile opuse ale bulei de replicare nou deschise.

DnaB este un helicase activitatea sa enzimatică constă în dezarhivarea / desfacerea ADN-ului în fața ADN polimerazei, pentru a-i da ADN monocatenar de citit și copiat. O face în asociere cu proteinele de legare ADN monocatenar (SSB) și ADN giraza. Funcția SSB este aproape auto-explicativă: ADN monocatenar este ca ARN în capacitatea sa de a forma structuri secundare complexe prin asocierea bazelor interne, deci SSB previne acest lucru. ADN giraza este o topoizomerază de tip II și este însărcinată cu introducerea supraîncărcării negative în ADN. Acest lucru este necesar, deoarece dezarhivarea ADN-ului de către helicază îl desfășoară și el (deoarece este o dublă helix) și provoacă introducerea unei supraînfășurări pozitive. Aceasta înseamnă că întreaga moleculă circulară se răsucește asupra sa: imaginați-vă ținând o bandă de cauciuc în două mâini și răsucind-o. Pe măsură ce supraîncărcarea se acumulează, ADN-ul devine mai strâns înfășurat, până la punctul că ar fi imposibil ca helicaza să-l dezarhiveze. DnaB / giraza poate ameliora acest stres tăind temporar ADN-ul dublu catenar, trecând o buclă a moleculei prin decalaj și resigilându-l.

Figura ( PageIndex <8> ). Topoizomerazele ADN de tip II, cum ar fi ADN-giraza, ameliorează supraîncărcarea prin tăierea temporară cu două fire.

Acest lucru (sperăm) are mult mai mult sens uitându-se la diagramă. Sau, întorcându-ne la banda de cauciuc, dați o bandă de cauciuc o răsucire sau două, apoi lipiți cele două capete. Dacă trageți banda de cauciuc și treceți o porțiune adiacentă a benzii de cauciuc prin acel snip, apoi reconectați capetele tăiate, veți descoperi că există o răsucire mai mică. Nifty, eh? În acest moment, unii dintre voi vor spune, dar dacă răsuciți o bandă de cauciuc plutitoare, așa cum s-ar putea imagina un cromozom circular ADN plutitor E coli, v-ați aștepta să se desfacă în mod natural. Din punct de vedere tehnic, da, dar datorită masei mari a cromozomului, a asocierii sale cu diverse proteine ​​și a membranei celulare și a vâscozității mediului său, nu se comportă ca și cum ar fi complet liberă.

Figura ( PageIndex <9> ). Detaliu acțiune ADN topoizomerază tip II. (A) În primul rând, enzima se leagă de ADN și inițiază o activitate endonuclează, tăind ambele fire ale ADN-ului în acel moment. (B) Această tranziție completă a ADN-ului (spre deosebire de o singură catenă tăiată de topoizomerazele de tip I) permite unei alte părți a aceleiași molecule de ADN să alunece prin decalaj. (C) În cele din urmă, cele două capete rupte temporar ale ADN-ului, care fuseseră ținute strâns pe loc de enzimă.

Odată ce oriC a fost deschis și helicazele s-au atașat de cele două părți ale furcii de replicare, mașina de replicare, numită replisomul, poate începe să se formeze. Cu toate acestea, înainte ca ADN polimerazele să ia poziții, acestea trebuie să fie pregătite. ADN polimerazele nu sunt capabile să unească două nucleotide libere individuale împreună, pentru a începe formarea unui acid nucleic, pot adăuga doar pe un fir preexistent de cel puțin două nucleotide. Prin urmare, o ARN polimerază specializată (RNAP și rsquos nu au această limitare) cunoscută sub numele de primază este o parte a replisomului și citește creează un fir scurt de ARN denumit grund pentru a se adăuga ADN polimeraza. Deși sunt necesare doar câteva nucleotide, primerii procarioti pot avea o lungime de până la 60 nt în funcție de specie.

Până în prezent au fost descoperite cel puțin cinci ADN polimeraze procariote. ADN polimeraza primară pentru replicare în E coli este ADN polimeraza III (Pol III). Pol I este, de asemenea, implicat în mecanismul de bază al replicării ADN-ului, în primul rând pentru a completa lacunele create în timpul sintezei de catenă întârziată (definită cu 3 pagini înainte) sau prin mecanisme de corectare a erorilor. ADN polimeraza II și recent descoperite Pol IV și Pol V nu participă la replicarea cromozomială, ci mai degrabă sunt utilizate pentru a sintetiza ADN atunci când anumite tipuri de reparații sunt necesare în alte momente ale ciclului de viață celular.

ADN polimeraza III este o holoenzimă cu mai multe subunități, cu subunități & alfa, & epsilon și & theta cuprinzând polimeraza centrală și & tau, & gamma, & delta, & delta& rsquo, & chi, & Psi, și & beta care se reunesc pentru a forma holoenzima completă. Polimeraza centrală are două activități: subunitatea & alfa este funcția polimerazei, citind un fir de ADN și sintetizând un fir complementar cu o viteză mare, în jur de 150 nt / sec subunitatea & epsilon este o exonuclează 3 & rsquo-5 & rsquo & ldquoproofreading & rdquo și acționează ca un corector imediat , îndepărtând ultimul nucleotid dacă este incorect. Această citire a dovezilor nu ajunge în spate: acționează doar pe cel mai recent nucleotid adăugat pentru a corecta încorporarea greșită. Alte mecanisme și enzime sunt utilizate pentru a corecta leziunile ADN care apar în alte momente. [Ca o chestiune de nomenclatură, exonucleazele tăie doar nucleotidele din ADN sau ARN de la ambele capete, dar nu la mijloc. Endonucleazele scindează legături fosfodiester situate mai adânc în cadrul unei catene de acid nucleic.] Subunitatea & theta nu are activitate enzimatică și reglează funcția de exonuclează. Deși are activitate polimerazică, polimeraza nucleului Pol III are o procesare slabă - adică poate adăuga doar până la 15 nucleotide înainte de a se disocia de ADN-ul șablon. Din moment ce genomurile de E coli tulpinile au în medie aproape 5 milioane de perechi de baze, replicarea în mici segmente de 15 nt ar fi extraordinar de ineficientă.

Figura ( PageIndex <10> ). Dimeric și beta clema deține ADN polimeraza III pe șablon, permițându-i polimerizarea mai multor nucleotide înainte de disociere.

Complexul de încărcare cu cleme este un ansamblu ATPase care se leagă de unitatea & beta-clamp după legarea ATP (dar activitatea ATPasei nu este activată). Când complexul se leagă apoi de ADN, activează ATPaza, iar hidroliza rezultată a ATP duce la modificări conformaționale care deschid temporar clema (pentru a înconjura sau a se deplasa din catena de ADN), și apoi disocierea încărcătorului de clemă de ansamblul clemei.

Aici este nevoie de subunitatea & beta. De asemenea, cunoscut sub numele de clema & beta, este un dimer de subunități semicirculare care are o gaură centrală prin care ADN-ul este filetat. Polimeraza centrală, printr-o interacțiune & alfa și beta, este atașată la această clemă & beta, astfel încât să rămână pe ADN mai mult, crescând procesivitatea Pol III la peste 5000nt. Clema & beta este încărcată pe (și descărcată din) ADN de un complex de încărcare a clemei (numit și complex & gamma) format din subunități & gamma (x3), & delta, & delta & rsquo, & chi și & Psi.

Balonul de replicare are două furci de replicare - odată ce ADN-ul este deschis (dezarhivat) la origine, se poate forma o mașină de replicare la fiecare capăt, cu helicele îndreptându-se în direcții opuse. Pentru simplificare, vom lua în considerare doar o deschidere de la stânga la dreapta & mdash în această discuție, înțelegând că același lucru se întâmplă cu cealaltă furcă, dar în direcția opusă.

Primul lucru pe care trebuie să-l observați atunci când priviți o diagramă a unei furci de replicare (Figura ( PageIndex <11> )) este că cele două porțiuni monocatenare ale ADN-ului șablon sunt anti-paralele. Acest lucru nu ar trebui să fie o surpriză în acest moment al cursului, dar introduce o problemă mecanică interesantă. Helicase deschide ADN-ul dublu catenar și conduce restul mașinii de replicare. Deci, în regiunea monocatenară care urmărește helicaza, dacă privim de la stânga la dreapta, un șablon șablon este de 3 & rsquo la 5 & rsquo (în albastru), în timp ce celălalt este de 5 & rsquo la 3 & rsquo (în roșu). Din moment ce știm că acizii nucleici sunt polimerizați prin adăugarea fosfatului 5 & rsquo al unui nou nucleotid la 3 & rsquo hidroxil al nucleotidei anterioare (5 & rsquo la 3 & rsquo, în verde), aceasta înseamnă că una dintre fire, numită suvita conducătoare, este sintetizat în aceeași direcție în care se mișcă mașina de replicare. Nicio problemă acolo.

Cealaltă catenă este problematică: privită liniar, noua catenă sintetizată ar merge de la 3 & rsquo la 5 & rsquo de la stânga la dreapta, dar ADN polimerazele nu pot adăuga nucleotide în acest fel. Cum rezolvă celulele această problemă? Au fost propuse o serie de posibilități, dar modelul actual este prezentat aici. Mașina de replicare constă din helicază, primaze și două holoenzime ADN polimerază III care se deplasează în aceeași direcție fizică (urmând helicaza). De fapt, complexele pol III sunt legate fizic prin intermediul subunităților & tau.

Figura ( PageIndex <11> ). Replicarea ADN în procariote.

Pentru ca șablonul șablon, care este de 5 & rsquo la 3 & rsquo de la stânga la dreapta, să fie reprodus, șuvița trebuie alimentată în polimerază înapoi. Acest lucru poate fi realizat fie prin rotirea polimerazei în jurul valorii, fie prin buclarea ADN-ului. Așa cum se arată în figură, modelul actual este că primaza se mișcă și ea de-a lungul stânga la dreapta, deci are doar un timp scurt pentru a sintetiza rapid un primer scurt înainte de a fi nevoit să avanseze cu replisomul și să pornească din nou, lăsând primerii intermitenți în trezirea sa. Din această cauză, Pol III este forțat să sintetizeze doar fragmente scurte ale cromozomului la un moment dat, numite fragmente Okazaki după descoperitorul lor. Pol III începe sintetizarea prin adăugarea de nucleotide pe capătul 3 & rsquo al unui primer și continuă până când atinge capătul 5 & rsquo al primerului următor. Nu (și nu poti) conectați firul pe care îl sintetizează cu capătul primerului 5 & rsquo.

Replicarea ADN se numește un proces semi-discontinuu, deoarece în timp ce catena principală este sintetizată continuu, catena laging este sintetizată în fragmente. Acest lucru duce la două probleme majore: în primul rând, există mici bucăți de ARN lăsate în urmă în firele nou fabricate (chiar la capătul 5 & rsquo pentru firul principal, în multe locuri pentru întârziere) și în al doilea rând, Pol III poate adăuga doar nucleotide libere la un fragment de ADN monocatenar nu poate conecta un alt fragment. Prin urmare, noul & ldquostrand & rdquo nu este întreg, ci plin de legături fosfodiester lipsite.

Prima problemă este rezolvată de ADN polimeraza I. Spre deosebire de Pol III, Pol I este o proteină monomerică și acționează singură, fără proteine ​​suplimentare. Există, de asemenea, de 10-20 ori mai multe molecule Pol I decât molecule Pol III, deoarece acestea sunt necesare pentru atâtea fragmente Okazaki. ADN Polimeraza I are trei activități: (1) cum ar fi Pol III, poate sintetiza o catenă de ADN pe baza unui șablon de ADN, (2), de asemenea, ca Pol III, este o exonuclează 3 & rsquo-5 & rsquo, dar spre deosebire de Pol III, (3) ) este, de asemenea, un 5 & rsquo-3 & rsquo exonuclease. Activitatea de exonuclează 5 & rsquo-3 & rsquo este crucială în îndepărtarea primerului ARN (Figura ( PageIndex <12> )). Exonucleaza 5 & rsquo-3 & rsquo se leagă de ADN bicatenar care are o ruptură monocatenară în coloana vertebrală a fosfodiesterului, cum ar fi ceea ce se întâmplă după ce fragmentele Okazaki au fost sintetizate de la un primer la altul, dar nu pot fi conectate. Această exonuclează 5 & rsquo-3 & rsquo îndepărtează apoi primerul ARN. Activitatea polimerazei adaugă apoi noi nucleotide ADN fragmentului din amonte Okazaki, completând golul creat prin îndepărtarea primerului ARN. Exonucleaza de corectură acționează la fel ca în cazul Pol III, eliminând imediat un nucleotid incorect nou încorporat. După corectură, rata generală de eroare a încorporării nucleotidelor este de aproximativ 1 din 107.

Din punct de vedere tehnic, exonucleaza 5 & rsquo-3 & rsquo clivează ADN-ul într-o regiune dublu-catenară în aval de nick și poate apoi să se îndepărteze oriunde de la 1-10nt la un moment dat. Experimental, activitatea de exonuclează 5 & rsquo-3 & rsquo poate fi scindată de restul Pol I de proteaza tripsină. Acest lucru generează fragmentul & ldquoKlenow & rdquo care conține polimeraza și 3 & rsquo-5 & rsquo corectură exonuclează.


Figura ( PageIndex <12> ). Sinteza Laging Strand. După ce ADN polimeraza III a extins primerii (galbeni), ADN polimeraza I îndepărtează primerul și îl înlocuiește prin adăugarea pe fragmentul anterior. Când termină de îndepărtat ARN și îl înlocuiește cu ADN, lasă ADN-ul cu o legătură fosfodiesterică lipsă între ADN-ul sintetizat pol III în aval și ADN-ul sintetizat pol I în amonte. Această ruptură a coloanei vertebrale zahăr-fosfat este reparată de ADN ligază.

Chiar dacă ARN-ul a fost înlocuit cu ADN, acesta lasă totuși un fir fragmentat. Ultimul jucător important din povestea replicării ADN-ului apare în cele din urmă: ADN ligaza. Această enzimă are o sarcină simplă, dar crucială: catalizează atacul 3 & rsquo-OH dintr-un fragment pe fosfatul 5 & rsquo al fragmentului următor, generând o legătură fosfodiesterică. Această reacție necesită energie sub formă de hidroliză fie a ATP, fie a NAD + în funcție de specie (E coli folosește NAD +) generând AMP și fie PPeu sau NMN +.


Structuri ADN necanonice bazate pe interacțiuni Guanină-Guanină Se pare că au jucat un rol în originea și evoluția telomerilor

În majoritatea cromozomilor eucariotici, secvențele ADN telomerice sunt matrici de secvențe repetitive scurte bogate în guanină care se termină într-o surplus 3'-monocatenar bogat în G (150-200 nucleotide). Catenă bogată în G este sintetizată de o RT specifică telomerilor, numită telomerază, utilizând o mică regiune a subunității sale de ARN ca șablon și 3'-OH la capătul cromozomului ca primer (Blackburn 1992). Găsit la animale, ciuperci și Amoebozoa, TTAGGG a fost secvența de repetare simplă telomerică prezentă în Unikont ancestral. Mai mult, apariția sa la unele specii din supergrupurile Plantae, Chromalveolata, Excavata și Rhizaria sugerează că TTAGGG ar putea fi secvența ancestrală de repetare telomerică pentru eucariote (Fulnecková et al. 2013).

Pe de altă parte, utilizarea retroelementelor procariote pentru a înrădăcina un arbore filogenetic RT arată că telomeraza pare să fi evoluat din RT a unui retrotransposon ancestral non-LTR (Eickbush 1997). Mai mult, se crede că abilitatea RT-urilor non-LTR de a folosi 3'-OH a capetelor cromozomiale pentru a transfera transcripția inversă a fost crucială pentru nașterea telomerazelor timpurii (Moore și Haber 1996 Morrish și colab. 2002, 2007 Curcio și Belfort 2007).

Telomerele bazate pe telomerază au adus două avantaje principale: homeostazia telomerilor facilitată și o protecție structurală mai mare prin încorporarea repetărilor simple bogate în G cu capacitatea inerentă de a forma structuri G-quadruplex (Henderson și colab. 1987 Arthanari și Bolton 2003 Teixeira și Gilson 2005 ). G-quadruplexele constau din cvartete G stivuite, care sunt aranjamente plane a patru guanine ținute împreună de legături de hidrogen Hoogsteen (Neidle 2009) (fig. 2A). Formarea G-quadruplex poate apărea în interiorul porțiunii 3'-bogate în G (fig. 2B) sau atunci când surplombul invadează regiunea dublu-catenară adiacentă a telomerului pentru a forma structuri în buclă T (fig. 2C) (Maizels 2006 Rhodes 2006 Xu și colab. 2008 Bochman și colab. 2012). Cu toate acestea, s-a emis ipoteza că după apariția telomerazei, menținerea telomerilor prin mecanismul primitiv de replicare a buclei T devine mai puțin relevantă (de Lange 2004). Prima vizualizare a formării telomerice de G-quadruplex in vivo a fost efectuată în ciliat Stylonychia (Schaffitzel și colab. 2001 Paeschke și colab. 2005). Cel mai recent, un anticorp AD-G-quadruplex foarte specific a fost folosit pentru a vizualiza structurile G-quadruplex la telomerii umani (Biffi și colab. 2013).

Diagramele schematice ale unui cvartet G și a două G-cvadruplex telomerice. (A) Patru guanine se adună într-un aranjament plan pentru a forma un cvartet G. Legăturile de hidrogen sunt în linii punctate. (B) Diagrama unui G-quadruplex intramolecular la capătul telomerilor. (C) Diagrama unui G-quadruplex la o buclă T. G-quadruplexele din figură sunt compuse din trei cvartete G stivuite (pătrate umbrite).

Diagramele schematice ale unui cvartet G și a două G-cvadruplex telomerice. (A) Patru guanine se asamblează într-un aranjament plan pentru a forma un cvartet G. Legăturile de hidrogen sunt în linii punctate. (B) Diagrama unui G-quadruplex intramolecular la capătul telomerilor. (C) Diagrama unui G-quadruplex la o buclă T. G-quadruplexele din figură sunt compuse din trei cvartete G stivuite (pătrate umbrite).

Este important să subliniem că secvența presupusă sintetizată prin telomerază ancestrală (TTAGGG)n, nu numai că este capabil să se plieze într-o structură G-quadruplex, ci este cel mai bun în a face acest lucru in vitro (Tran și colab. 2011). În plus, recentele studii biofizice asupra plierii acestor G-quadruplexe telomerice au arătat că formarea structurii are loc în milisecunde. Aceste cinetice de pliere sunt relevante din punct de vedere biologic, deoarece sunt comparabile cu cele ale transcripției și ale replicării ADN-ului (Zhang și Balasubramanian 2012).

În timpul evoluției, mutațiile din șablonul de ARN telomerază au dat naștere la repetarea variantelor cu diferite lungimi de motive de guanină (G2, G4, și altele). Experimente recente au descoperit că G-quadruplexele formate din repetiții telomerice cu doar două guanine consecutive (TTAGG în artropode și TTAGGC în nematode) sunt în echilibru cu acele de păr G și alte structuri necanonice (Tran și colab. 2011).

În molia de mătase Bombyx mori (Lepidoptera) și gândacul de făină Tribolium castaneum (Coleoptera), activitatea telomerazei este slabă, iar retroelementele non-LTR specifice telomerilor (TRAS și SART elemente familiale în B. mori și SART elemente familiale în T. castaneum) sunt inserate în repetările telomerice într-un mod specific (Fujiwara și colab. 2005 Osanai și colab. 2006) care păstrează părtinirea firului G / C (fig. 3). Integrarea masivă a acestor elemente în regiunile proximale ale matricilor repetate TTAGG ale B. mori și matricile TCAGG ale T. castaneum (o variantă alternativă de telomeri la insecte) dă naștere unor telomeri uriași cu dimensiuni mai mari de 200 kb.

Distribuția secvențelor telomerice în Bilateria. Cele mai multe eucariote au repetări sintetizate cu telomerază bogate în G cu repetări subtelomerice complexe adiacente numite secvențe asociate telomerilor (TAS). La majoritatea artropodelor, retrotranspozițiile specifice telomerilor sunt inserate în repetări sintetizate cu telomerază. După cum se poate vedea în diagramă, TRAS elementele se inserează în orientare inversă cu cea a SART elemente. La un strămoș al insectelor diptiene, gena telomerazei s-a pierdut (linia verde). În Chironomus tentans (Diptera inferioară), secvențele telomerice constau în repetări complexe în tandem menținute prin recombinare. In orice caz, Drosophila speciile au mai mulți retrotranspozoni specifici telomerilor (autonomi și neautonomi) care se transpun în capetele cromozomiale. Evenimentul de ștergere din elementul TAHRE ancestral este afișat cu linii punctate.

Distribuția secvențelor telomerice în Bilateria. Majoritatea eucariotelor au repetări sintetizate cu telomerază bogate în G cu repetări adiacente subtelomerice complexe numite secvențe asociate telomerilor (TAS). In most arthropods, telomere-specific retrotransposons are inserted into telomerase-synthesized repeats. As can be seen in the diagram, TRAS elements insert in reverse orientation to that of the SART elemente. In an ancestor of diptean insects, the telomerase gene was lost (green line). În Chironomus tentans (lower Diptera), the telomeric sequences consist of complex tandem repeats maintained by recombination. In orice caz, Drosophila species have multiple telomere-specific retrotransposons (autonomous and nonautonomous) that transpose to chromosomal ends. The deletion event in the ancestral TAHRE element is shown with dashed lines.

The telomeres of the honey bee Apis mellifera (Hymenoptera) are exceptional among the arthropods because they do not have non-LTR elements inserted into their telomeric repeats. Instead, the telomere sequence consists of TTAGG repeat arrays ( Robertson and Gordon 2006) interspersed with TCAGGCTGGG, TCAGGCTGGGTTGGG, and TCAGGCTGGGTGAGGATGGG higher order repeat arrays (Garavís M, Villasante A, unpublished results) ( fig. 3). These higher order repeats arose by amplification of the mutated repeats present in proximal telomeric regions and the interspersed pattern developed by further amplifications of the 5-bp repeat arrays together with higher order repeat arrays. However, the TTAGG repeats of Acyrthosiphon pisum (Hemiptera) and Pediculus humanus (Phthiraptera) contain insertions of non-LTR retrotransposons of the TRAS și SART family, respectively ( International Aphid Genomics Consortium 2010 Kirkness et al. 2010) ( fig. 3). As Hemiptera and Phthiraptera are basal to Hymenoptera, Coleoptera, Lepidoptera, and Diptera ( fig. 3), the telomeres of A. mellifera seem to represent a case where the TRAS și / sau SART retrotransposons were lost at a later stage in evolution. It is tempting to speculate that the appearance of those higher order repeat arrays with propensity to form 3-quartet G-quadruplexes caused the decay, and eventual loss, of the telomeric retrotransposons.

Because the telomeres of the spider mite Tetranychus urticae (from the basal branch Chelicerata) are also a mosaic of short TTAGG repeats interrupted by non-LTR retrotransposons closely related to TRAS ( Grbić et al. 2011) ( fig. 3), the telomeres of the arthropods seem to be maintained by telomerase, by insertion of specific non-LTR retrotransposons into the TTAGG repeat array and by recombination. The same system of telomere maintenance has also been found in some nonarthropod species ( Arkhipova and Morrison 2001 Yamamoto et al. 2003 Gladyshev and Arkhipova 2007 Starnes et al. 2012). It has not escaped our notice that the appearance of this apparently suboptimal mechanism of telomere maintenance, which might have created chromosome instability, seems to have coincided with the great arthropod radiation into Chelicerata and Mandibulata.

On the other hand, certain yeasts from the Ascomycota phylum have telomeric repeats that are diverse in terms of their sequence, length, and homogeneity ( McEachern and Blackburn 1994). In these yeasts, the degenerate repeats result from the nonprocessivity of their telomerases ( Prescott and Blackburn 1997). Importantly, these repeats, despite their TG-richness, are less prone to fold into G-quadruplexes ( Tran et al. 2011), and it has been shown that in these organisms, the telomere-binding proteins are fast evolving ( Teixeira and Gilson 2005). Therefore, it is possible that these yeasts are using an ancestral system of chromosome end protection where the ssDNA-binding proteins facilitate the folding of the 3′-overhangs into G-quadruplex-like structures. This yeast-capping mechanism likely arose de novo by convergent evolution.

Do Noncanonical Secondary Structures Have a Role in the Maintenance of Telomeres without Telomerase?

Once telomerase becomes completely dysfunctional, the gene encoding telomerase could be lost if telomeres are maintained by the ancestral alternative mechanism of homologous recombination. Apparently, this is what happened in the ancestor of Diptera about 260 Ma ( Wiegmann et al. 2011). In the lower Diptera, Anofel, Rhynchosciara, și Chironomus, long tandem repeats are present at chromosome ends, suggesting that telomere maintenance takes place by homologous recombination ( Nielsen and Edstrom 1993 Biessmann et al. 1998 Madalena et al. 2010) ( fig. 3). În Drosophila, however, telomere maintenance occurs primarily by transposition of telomere-specific retrotransposons to receding chromosome ends ( fig. 3). In addition to retrotransposition, Drosophila telomeres are also maintained, as in any eukaryote, by recombination/gene conversion ( Kahn et al. 2000).

În D. melanogaster, three telomeric retrotransposons TART, TAHRE, și HeT-A (a nonautonomous element derived from an ancestral TAHRE that loss its RT), transpose occasionally to chromosome ends using the free 3′-OH at chromosome termini to prime reverse transcription ( Biessmann et al. 1990, 1992 Sheen and Levis 1994 Abad et al. 2004a, 2004b). In agreement with this mechanism, the telomeric elements appear randomly mixed in head-to-tail arrangements and variably truncated at the 5′-end ( Mason et al. 2008 Villasante et al. 2008 Pardue and DeBaryshe 2011) ( fig. 3). It is noteworthy that deletion of the RT coding region of the telomeric elements has occurred recurrently during Drosophila evolution, and multiple nonautonomous elements appear at the telomeres of the Drosophila species examined. As an example, up to four nonautonomous elements along with their corresponding autonomous elements have been found in D. mojavensis telomeres ( Villasante et al. 2007). Interestingly, similar situations occur with group II introns where their RTs also act in trans to mobilize multiple deleted introns ( Mohr et al. 2010).

pentru că Drosophila telomeres consist of retrotransposon arrays in constant flux, there is not a specific terminal sequence and their telomere-capping proteins (the “terminin” complex) have evolved to bind chromosome ends independently of the primary DNA sequence ( Raffa et al. 2009, 2010). The “terminin” complex is functionally analogous to the “shelterin” complex (human telomere-capping proteins), but their components are not evolutionarily conserved ( Palm and de Lange 2008 Raffa et al. 2009, 2010). Prin urmare, Drosophila telomeres are made of rapidly evolving telomeric retrotransposons ( Villasante et al. 2007) and telomere-capping proteins ( Gao et al. 2010 Raffa et al. 2010). Moreover, as Verrochio is a telomere-capping protein with one OB-fold domain and all telomeric proteins containing OB folds are 3′-overhang binding proteins, Drosophila telomeres also seem to have single-strand overhangs ( Raffa et al. 2010).

It is noteworthy that, despite the complexity of telomeric sequences in the genus Drosophila și Chironomus, Drosophila telomeric retrotransposon arrays and the Chironomus telomeric complex repeats also have the telomeric G/C strand bias ( Nielsen and Edstrom 1993 Danilevskaya et al. 1998). The conservation of this G/C strand bias may indicate that telomere capping depends on the formation of noncanonical structures based on guanine–guanine interactions. In agreement with this idea, it has been shown that the 3′-untranslated region of the abundant D. melanogaster telomeric element HeT-A contains sequences with propensity to form G-quadruplexes ( Abad and Villasante 1999).

The structural and phylogenetic analyses of all Drosophila telomeric-specific retrotransposons show that they had a common ancestor and indicate that non-LTR retrotransposons have been recruited to perform the cellular function of telomere maintenance. Therefore, we propose that the recruitment of Drosophila telomeric elements may resemble the ancestral mechanism that led to the maintenance of the “proto-telomeres” of the first eukaryotic chromosomes.

On the other hand, it has been found that yeast cells lacking telomerase can survive telomere sequence loss through the formation of terminal blocks of heterochromatin. This happens by amplifying and rearranging either subtelomeric sequences in S. cerevisiae și S. pombe or rDNA sequences in S. pombe ( Lundblad and Blackburn 1993 Jain et al. 2010). Significantly, the S. cerevisiae subtelomeric Y’ repeats also have purine/pyrimidine strand bias ( Nickles and McEachern 2004), and the S. pombe end-protection protein POT1 (protection of telomeres 1) binds, in a nonsequence-specific manner, to the 3′-overhangs of G-rich rDNA ( Jain et al. 2010). Interestingly, adaptive recombination-based mechanisms of telomere maintenance (called ALT for alternative lengthening of telomeres) also occur in tumor cells that lack telomerase ( Bryan et al. 1995 Cesare and Reddel 2010).

To summarize, in species that have lost telomerase either during evolution (order Diptera) or through experimental manipulation, the data available suggest a role of structural DNA features in telomere maintenance, reveal the importance of telomeric heterochromatin (regardless of the underlying primary sequence) in the recruitment of end-binding proteins, and show how easily backup mechanisms may have been used to maintain telomeres during evolution.


Difference Between VNTR and STR

Definiție

VNTR: VNTR is a type of tandem repeat in which a short sequence of nucleotides (10-60 base pairs) are repeated a variable number of times in a particular locus.

STR: STR is a type of tandem repeat in which a short sequence of nucleotides (2-6 base pairs) are repeated a variable number of times in a particular locus.

Number of Repeating Nucleotides

VNTR: VNTR consists of 10-60 base pairs.

STR: STR consists of 2-6 base pairs.

Type of Repetitive DNA

VNTR: VNTR is a type of minisatellite DNA.

STR: STR is a type of microsatellite DNA.

Number of Repeats

VNTR: VNTR consists of 10-1,500 repeats in the array.

STR: STR consists of 5-200 repeats in the array.

Size of the Array

VNTR: VNTR forms an array of 0.5-15 kb.

STR: STR forms an array of 10-1000 bp.

Complexity of the Array

VNTR: VNTR produces heterogeneous arrays.

STR: STR produces homogenous arrays.

Concluzie

VNTR and STR are two types of tandem repeats that form arrays of adjacent repetitive units in the eukaryotic genome. VNTR consists of comparatively a long repeating units of nucleotides (10-60 base pairs). STR consists of short repeating units of nucleotides (2-6 bp). The main difference between VNTR and STR is the length of the repeating units of each type of tandem repeats.

Referinţă:

1. “Variable number tandem repeat.” ScienceDirect Topics, Available here.
2. “The Science of Forensic Genetics.” CRG – Council for Responsible Genetics, Available here.

Image Courtesy:

1. “D1S80Demo” By PaleWhaleGail at English Wikipedia (CC BY-SA 3.0 ) via Commons Wikimedia
2. “Stages of Gene Fingerprinting” By Sneptunebear16 – Own work (CC BY-SA 4.0) via Commons Wikimedia

About the Author: Lakna

Lakna, a graduate in Molecular Biology & Biochemistry, is a Molecular Biologist and has a broad and keen interest in the discovery of nature related things


Binding and interaction of α-synucleinwith lipid membranes

Under normal conditions, α-synucleinexists as a randomly structured and natively unfolded protein and remains as a monomer within the cytoplasm. Under pathological conditions, however, α-synucleinundergoes structural/conformational changes causing the monomers to aggregate with each other and become insoluble. Much evidence suggests that changes to the α-synucleinstructure and properties are initiated when the protein binds and interacts with lipid surfaces, such as lipid droplets, phospholipid bilayers or lipid membranes. When α-synucleinmonomers, isolated from human neurons, were exposed to synthetic lipid membranes, they readily bound to the membrane surface and formed dimers and oligomers [56],[57]. Such an interaction is thought to induce a dramatic change in α-synucleinstructure from its unfolded form to a folded α-helical secondary structure [57]. The imperfect repeats of 11 amino acids present in α-synuclein, similar to the amphipathic α-helical motif common to apolipoproteins and other lipid-binding proteins, appear to play an important role in the lipid membrane binding process [58]. What is significant about such a change is that the α-helical form of α-synucleinis prone to forming different types of oligomers, the species that are thought to be toxic to cells. The lipid composition of membranes has been shown to affect the binding/interaction of α-synucleinto the membrane and subsequent oligomerization [56],[59]. α-synucleinis thought to preferentially bind to regions of membranes that are enriched in lipids [60]. These regions are called lipid rafts and are characterized by high concentrations of cholesterol and sphingolipids and altered surface charge that may favor α-synucleinbinding. The lipid rafts appear to serve as a platform that promotes α-synucleinbinding and oligomerization.

Contrary to overwhelming evidence that α-synuclein exists as an unfolded monomer in the cytosol, Bartels and colleagues reported that endogenous α-synuclein exists predominantly as a folded tetramer (

58 kDa) [61]. The explanation provided by the authors for this apparent difference is that most studies claiming the unfolded monomer hypothesis commonly use sample heating and denaturing gels to analyze α-synuclein, whereas the authors used nondenaturing conditions. They have also provided evidence by other means - that is, scanning transmission electron microscopy and cell cross-linking - to confirm the prevalence of α-synuclein tetramer in neurons and human brain tissues [61]. Bartels and colleagues proposed that since α-synuclein tetramers are less likely to form aggregates, the tetramers first undergo destabilization prior to forming aggregates. The authors suggested that stabilizing the physiological tetramers could reduce Contrary to overwhelming evidence that-synuclein pathogenicity in PD and other α-synucleinopathies.


Secondary Structure: α-Helices

An &alpha-helix is a right-handed coil of amino-acid residues on a polypeptide chain, typically ranging between 4 and 40 residues. This coil is held together by hydrogen bonds between the oxygen of C=O on top coil and the hydrogen of N-H on the bottom coil. Such a hydrogen bond is formed exactly every 4 amino acid residues, and every complete turn of the helix is only 3.6 amino acid residues. This regular pattern gives the &alpha-helix very definite features with regards to the thickness of the coil and the length of each complete turn along the helix axis.

The structural integrity of an &alpha-helix is in part dependent on correct steric configuration. Amino acids whose R-groups are too large (tryptophan, tyrosine) or too small (glycine) destabilize &alpha-helices. Proline also destabilizes &alpha-helices because of its irregular geometry its R-group bonds back to the nitrogen of the amide group, which causes steric hindrance. In addition, the lack of a hydrogen on Proline's nitrogen prevents it from participating in hydrogen bonding.

Another factor affecting &alpha-helix stability is the total dipole moment of the entire helix due to individual dipoles of the C=O groups involved in hydrogen bonding. Stable &alpha-helices typically end with a charged amino acid to neutralize the dipole moment.


Concluzii

In this study, we applied an integrated omics approach to understand dinoflagellate secondary metabolite biosynthesis. To this end, we sequenced the genome of A. gibbosum and identified key features that regulate secondary metabolite levels and structural diversity. We hypothesize that miRNA-mediated, post-transcriptional regulation in A. gibbosum, which targets primary pyruvate metabolism, subsequently affects secondary metabolism. This study represents a first step to illuminate key molecular events involved in dinoflagellate secondary metabolism, and it should facilitate studies of HAB formation and associated toxin production. Ongoing high-throughput sequencing of dinoflagellate genomes promises to be informative, not only for understanding toxin secondary metabolism genes, but also for better insights into their genome organization. The availability of this first basal dinoflagellate genome provides important clues about dinoflagellate evolution and extends the genome size limit that has been a challenge for several years.


Primer Based Approach for PCR Amplification of High GC Content Gene: Mycobacterium Gene as a Model

The genome of Mycobacterium is rich in GC content and poses problem in amplification of some genes, especially those rich in the GC content in terminal regions, by standard/routine PCR procedures. Attempts have been made to amplify three GC rich genes of Mycobacterium sp. (Rv0519c și Rv0774c din M. tuberculoza și ML0314c din M. leprae). Out of these three genes, Rv0774c gene was amplified with normal primers under standard PCR conditions, while no amplification was observed in case of Rv0519c și ML0314c gene. In the present investigation a modified primer based approach was successfully used for amplification of GC rich sequence of Rv0519c through codon optimization without changing the native amino acid sequence. The strategy was successfully confirmed by redesigning the standard primers with similar modifications followed by amplification of ML0314c genă.

1. Introduction

Polymerase chain reaction (PCR) based cloning of gene of interest with high GC content is a long recognized problem. PCR is a most sensitive tool and various factors have to be optimized for amplification of gene of interest. Primer is one of the precise control elements in this process. Designing of primers directly influences the result of standardized cloning procedures. High GC content of the gene generates complication during primer designing like mismatch and high annealing temperature, self-dimer formation, and secondary structure. Sometimes, amplification of gene is not routinely achieved by normal PCR techniques. The most prominent problem associated is hairpin loop, which directly interferes during annealing of primers on difficult DNA template that leads to no amplification. Different strategies have been proposed to sort out this problem. Use of DMSO and glycerol was reported to reduce the annealing temperature and denaturation temperature, increase the chances of breakage of secondary structure, and increase the efficiency of amplification [1–5]. The whole genome sequence of Mycobacterium tuberculosis was deciphered by Cole et al. [6]. The genes of M. tuberculoza are being cloned and expressed in E coli cells in order to identify their possible role in Mycobacterium life. The Mycobacterium genome has very high GC content (66%) which raised the possibility of hairpin structure in the genomic structure. From genome sequence analysis it was observed that PPE, PE, and PGRS multigene family code for proteins of approximately 110–80 amino acids rich in proline and glutamic acid at N-terminal position. Proline and glutamic acid residues are mainly coded by triplet of GC bases in Mycobacterium genome. Most of the genes for membrane proteins of M. tuberculoza were rich in GC content at terminal regions. Presence of high GC content increased the annealing temperature beyond the extension temperature (72°C) and also repeated stretches generate the hairpin structure. In such cases, effectiveness and reproducibility of PCR amplification depend on detailed analysis of the possible secondary structures of the oligonucleotide primers as well as formation of self-dimers and cross-dimers with other interrelating oligonucleotides [7]. Though these problems have been considered by several investigators, no systematic details are available to approach this problem.

In an attempt to clone GC rich genes (Rv0519c și Rv0774c din M. tuberculoza și ML0314c din M. leprae) from Mycobacterium sp., we designed primers by using standard method for gene amplification. Rv0774c și Rv0519c genes demonstrated 100% nucleotide identity in M. tuberculoza H37Rv and M. tuberculoza H37Ra. Therefore, M. tuberculoza H37Ra chromosomal DNA was used as template for amplification of these two genes. We could amplify Rv0774c gene, but Rv0519c și ML0314c genes having high GC content at terminal region were not amplified by standard PCR procedures. Therefore, an attempt has been made in the present investigation to standardize the conditions and ingredients that favor the amplification of GC rich sequences.

2. Materiale și metode

2.1. Materiale

E coli DH5α cells and pET-28a were procured from Invitrogen. Taq polymerase and dNTPs were purchased from Fermentas, USA. Restriction enzymes were purchased from New England Biolabs. Kanamycin, Middlebrook media, OADC, and tween 80 were purchased from Hi-Media, India. The strain Mycobacterium tuberculosis H37Ra was a kind gift from Director of National Institute of Leprosy and Other Mycobacterial Diseases, Agra, India. Genomic DNA for Mycobacterium leprosy was a kind gift from Dr. Mallika Lavania of Stanley Browne Laboratory, the Leprosy Mission, Nandnagri, Shahdara, New Delhi.

2.2. Mycobacterium Genomic DNA Isolation

M. tuberculoza H37Ra strains were routinely cultured for one week on middlebrook, 0.05% Tween 80, enriched with OADC. One week grown M. tuberculoza H37Ra cells (1.5 mL) were harvested by centrifugation at 5000 ×g for 20 min. Harvested pellet was resuspended in 400 μL Tris-EDTA buffer (100 mM Tris/10 mM EDTA, pH 8). The cells were lysed by putting the sample in boiling water bath for 5 min followed by cooling on ice for 5 min. Forty microliters of 20 mg/mL lysozyme and 5 μL of proteinase K were added. After 1 h of incubation at 37°C, solution A (56 μL of 10% SDS, 64 μL of CTAB-NaCl) was added to the reaction mixture. After 2 h of incubation at 65°C, proteins were removed by 2-3 times of washing with phenol : chloroform : isoamyl alcohol (25 : 24 : 1). The genomic DNA was precipitated with 0.6 volume of isopropanol at room temperature for 1 h. The precipitated DNA was dried and dissolved in sterile water and stored at −20°C.

2.3. Modification of Primers by Codon Optimization

Degeneracy of codon is normally used to overcome the existing problem including change of base at wobble position specific for coding sequence of Mycobacterium genome. Designed forward primer of Rv0519c contributes about 64% GC content and stretches of GC led to generation of complicated hairpin structure with high value of free energy change

G. By carefully examining the hairpin structure, introduction of the small base/pair distorted the whole secondary structure. The incorporation we opted in the primer sequence was as follows: guanine (G) base turned into adenosine (A) at wobble position of third codon CGG and thymine (T) to adenine (A) in codon CGT (Table 1). Similarly in reverse primer of Rv0519c primer sequence, the adenosine (A) base was turned into thymine (T) at wobble position of last sixth codon CGA. Mycobacterium leprae genome sequence also has high guanine and cytosine stretches. Reverse primer sequence of ML0314c de leprae gene was also modified. Guanine was turned into cytosine at wobble position of TCG codon. The effect of modification was analysed by IDT oligoanalyzer tools.


Priveste filmarea: Structura repetitiva condiționată anterior (Ianuarie 2022).