Informație

Există proteine ​​care stabilizează mARN: ARN polimerază sau complex mARN: ribozom?


Actinomicetele sunt cunoscute pentru capacitatea lor de a produce o varietate bogată de produse naturale și, în special, polichetide. Multe dintre genele care codifică căile biosintetice sunt destul de mari, deoarece ar putea ajunge la 20kb. Aceste bacterii au cel mai probabil un fel de mecanism care ar asigura transcrierea și traducerea eficientă a acestor ORF lungi. Acest lucru se poate face în două moduri: fie prin stabilizarea complexului mARN: ARN polimerază, fie prin stabilizarea complexului mARN: ribozom. Ați auzit vreunul dintre voi despre astfel de mecanisme în bacterii?


Am căutat informații despre acest subiect deoarece obișnuiam să lucrez în domeniul biosintezei proteinelor, dar fără succes. Cu toate acestea, un argument împotriva tendinței ca ribozomii să cadă de ARNm este mecanismul foarte specific pentru eliberarea ribozomilor după ce codonul de oprire a fost atins (descris aici).

Există alte posibile probleme cu ARNm foarte lungi:

  • Posibilă degradare a ARNm (procariot) pe parcursul unui timp îndelungat de traducere. Mi-aș imagina că ARNm ar trebui să conțină caracteristici structurale care i-au prelungit viața.
  • Posibilă îndoire și precipitare a produsului proteic înainte ca întreaga proteină să fie finalizată. Cred că există probabil proteine ​​chaperone care protejează regiunile hidrofobe sau încurajează plierea domeniilor pentru a preveni acest lucru.

Ca o notă de subsol, se crede că cel mai lung ARNm este cel pentru proteina musculară, titina. Asamblarea acestuia pe sarcomer nu ar fi tipică pentru polichetide, să zicem, dar alte probleme întâmpinate ar putea fi similare.


Există într-adevăr o genă, numită nusG, despre care se crede că este un antiterminator al transcripției ARN. NusG se leagă de ARN polimeraza, ceea ce duce la creșterea ratei de alungire a ARN, scăderea timpului în care polimeraza se află în stări de pauză de scurtă durată și suprimă stările de pauză stabilizate de lungă durată 1.

S-a dovedit că NusG este important pentru descoperirea și biosinteza produselor naturale:

Supraexprimarea nusG în C. cellulolyticum a permis izolarea a șapte analogi noi ai clostioamidei, numite clostioamide B-H86. Acești compuși noi sunt derivați trunchiați și parțial substituiți cu O ai compusului hexathioamidă părinte antibacterian, dar au o activitate antibacteriană substanțial mai mică 2

Mai mult, gena asemănătoare nusG se găsește în grupul de gene Myxococcus xanthus care ecodează mixovirescina (TA) antibiotic. Una dintre genele care codifică polichidele din acest cluster are o lungime de ~ 27kb [3]:

  1. Herbert, K. M. și colab. E. coli NusG inhibă urmărirea înapoi și accelerează transcrierea fără pauze prin promovarea translocării înainte a ARN polimerazei. J. Mol. Biol. 399, 17-30 (2010)

  2. Peter J. Rutledge și Gregory L. Challis. Descoperirea produselor naturale microbiene prin activarea grupurilor de gene biosintetice silențioase. Nature Reviews Microbiology 13, 509-523 (2015)

  3. http://mibig.secondarymetabolites.org/repository/BGC0001025/index.html#cluster-1


Transcriere primară

A transcriere primară este produsul acid ribonucleic monocatenar (ARN) sintetizat prin transcrierea ADN-ului și procesat pentru a produce diverse produse ARN mature, cum ar fi ARNm, ARNt și ARNr. Transcrierile primare desemnate a fi ARNm sunt modificate în pregătirea traducerii. De exemplu, a ARNm precursor (pre-ARNm) este un tip de transcript primar care devine ARN messenger (ARNm) după procesare.

Pre-ARNm este sintetizat dintr-un șablon de ADN din nucleul celulei prin transcripție. Pre-ARNm cuprinde cea mai mare parte a ARN nuclear eterogen (ARNh). Odată ce pre-ARNm a fost complet procesat, acesta este denumit „ARN mesager matur”, sau pur și simplu „ARN mesager”. Termenul hnRNA este adesea folosit ca sinonim pentru pre-mARN, deși, în sens strict, hnARN poate include transcrieri de ARN nuclear care nu ajung ca ARNm citoplasmatic.

Există mai mulți pași care contribuie la producerea transcrierilor primare. Toți acești pași implică o serie de interacțiuni pentru a iniția și finaliza transcrierea ADN-ului în nucleul eucariotelor. Anumiți factori joacă un rol cheie în activarea și inhibarea transcrierii, unde reglează producția primară de transcrieri. Transcrierea produce transcrieri primare care sunt modificate în continuare de mai multe procese. Aceste procese includ capacul 5 ', 3'-poliadenilarea și îmbinarea alternativă. În special, îmbinarea alternativă contribuie direct la diversitatea ARNm găsit în celule. Modificările transcrierilor primare au fost studiate în continuare în cercetarea care urmărește o mai bună cunoaștere a rolului și semnificației acestor transcrieri. Studiile experimentale bazate pe modificări moleculare ale transcrierilor primare și procesele înainte și după transcriere au condus la o mai bună înțelegere a bolilor care implică transcrieri primare.


Extinderea spațiului dintre secvența Shine – Dalgarno și codonul P-Site reduce rata de translocare a ARNm

Secvențele ARNm Shine – Dalgarno (SD) reglează alungirea traducerii.

Extinderea distanțierului dintre secvența SD și codonul sitului P destabilizează interacțiunile ARNm-ARNt-ribozom.

Extinderea distanțierului între secvența SD și codonul sitului P inhibă translocația ARNm.

Prin formarea interacțiunilor de asociere a bazelor cu capătul 3 ′ al 16S rARN, secvențele mRNA Shine – Dalgarno (SD) poziționate în amonte de cadrele de citire deschise facilitează inițierea traducerii. În timpul fazei de alungire a sintezei proteinelor, secvențele intragenice de tip SD stimulează schimbarea cadrelor ribozomilor și, de asemenea, pot încetini mișcarea ribozomilor de-a lungul ARNm. Aici, arătăm că lungimea distanțierului dintre secvența SD și codonul sitului P afectează puternic rata de translocație a ribozomilor. Creșterea lungimii distanțierului dincolo de 6 nt destabilizează interacțiunile ARNm-ARNt-ribozom și are ca rezultat o reducere de 5 până la 10 ori a ratei de translocație. Aceste observații sugerează că în timpul traducerii, distanțierul dintre secvența SD și codonul site-ului P suferă rearanjări structurale, care încetinesc translocația ARNm și promovează schimbarea cadrului ARNm.


REZULTATE

Omologia PTB1 și PTB2 la PTB la mamifere

Inspecția T. brucei genomul a dezvăluit mai multe proteine ​​care ar putea participa la reglarea trans-splicing (Liang et al. 2003). Două proteine ​​identificate anterior, DRBD3 și DRBD4, au similaritate cu PTB la mamifere (De Gaudenzi și colab. 2005). Pe baza acestei omologii, am redenumit DRBD3 ca PTB1, această proteină este adnotată în GeneDB ca Tb09.211.0560. Am redenumit DRBD4 ca PTB2, care este adnotat ca Tb11.01.5690. Pentru a demonstra în continuare că aceste proteine ​​sunt de fapt T. brucei Omologi PTB, am comparat structura T. brucei proteine ​​pentru proteinele PTB umane (<"tip": "întrez-protein", "attrs": <"text": "NP_002810.1", "term_id": "4506243" >> NP_002810.1 și tip nPTB <" ":" întrez-protein "," attrs ": <" text ":" NP_067013.1 "," term_id ":" 10863997 ">> NP_067013.1). O comparație schematică a structurii putative a domeniului este dată în Figura 1A, iar identitatea și similitudinea domeniilor RRM ale proteinelor umane cu PTB1 sau PTB2 sunt prezentate în Figura 1B. Pozițiile domeniilor RRM în proteine ​​sunt indicate în casete, iar săgețile leagă reziduurile care sunt legate în fiecare domeniu. Datele prezentate în Figura 1 sugerează că RRM 1 și RRM 2 din T. brucei PTB1 sunt legate în principal de RRM-uri corespunzătoare ale proteinelor umane PTB și nPTB RRM1, RRM 2 și RRM 3 ale T brucei PTB2 seamănă cel mai mult cu RRM1, RRM3 și RRM4 ale proteinelor umane PTB și nPTB. T. brucei PTB2 nu conține omologul RRM2 uman. Există un domeniu vestigial RRM la pozițiile 98 și # x02013163 ale proteinei care seamănă cel mai mult cu RRM 2 al proteinei umane. De fapt, baza de date a domeniului (bazată pe programele SMART, FPAM, PROSITE și INTERPROSCAN) nu a putut detecta un domeniu omolog RRM2. Numai când am folosit programul SMART, cu secvența de aminoacizi 98 și # x02013163, acest domeniu a fost identificat ca un domeniu RRM, deși cu un scor relativ slab. Am denumit acest domeniu divergent RRM X.

Reprezentarea schematică a comparației între PTB uman (PTB1 și nPTB) și Tb PTB (PTB1 și PTB2). Secvența de aminoacizi a proteinelor de mamifere PTB1 (<"tip": "întrez-protein", "attrs": <"text": "NP_002810.1", "term_id": "4506243" >> NP_002810.1) și nPTB (<"type": "entrez-protein", "attrs": <"text": "NP_067013.1", "term_id": "10863997" >> NP_067013.1) au fost comparate cu tripanosomul PTB1 (Tb09.211.0560 ) și PTB2 (Tb11.01.5690) folosind programul pBLAST (Altschul și colab. 1997) și Psi BLAST (Altschul și colab. 1997). Pentru a examina legătura fiecăruia dintre domeniile RRM ale proteinelor de mamifer cu secvențele corespunzătoare de tripanosomi, au fost utilizate programele SMART, FPAM, PROSITE și INTERPROSCAN. Poziția domeniilor RRM la mamifere s-a bazat pe date de la Wagner și Garcia-Blanco (2001). (A) Comparație între domeniile RRM. Fiecare domeniu RRM este în cutie. Aminoacizii care sunt legați între proteinele PTB sunt conectați cu săgeți, iar pozițiile exacte sunt date în afara cutiei. (B) Relația (identitatea și similitudinea) dintre domeniile RRM sunt prezentate între proteinele PTB specificate în A.

Am urmărit în continuare întregul genom, precum și lista tuturor proteinelor care conțin RRM din T. brucei (De Gaudenzi și colab. 2005) cu izoformele PTB umane (indicate în Fig. 1). Cele două proteine ​​care au apărut în partea de sus a listei au fost PTB2 (7e & # x022121019) și PTB1 (3e & # x02212016).

Tacerea de către RNAi a PTB1 și PTB2 demonstrează că ambii factori sunt esențiali pentru creștere

Pentru a examina rolul proteinelor PTB în metabolismul ARN-ului tripanosom și, în special, pentru a determina dacă acești factori participă trans- și cis-explicare, expresia acestor gene a fost redusă la tăcere de ARNi. PTB1 și PTB2 au fost amplificate de la genom și au fost proiectate constructele stem & # x02013loop. Construcțiile au fost compuse dintr-o tulpină de 479 de perechi de baze (bp) pentru PTB1 și o tijă de 443 bp pentru PTB2, și ambele au purtat un material derivat din Pex secvențe (Wang și colab. 2000). Aceste construcții au fost clonate în aval de un promotor EP reglementat de tetraciclină și utilizate pentru transfectare T. brucei (29-13) exprimând represorul tetraciclinelor și polimeraza T7 (Wang și colab. 2000). Celulele clonate care exprimă constructele au fost selectate pe fleomicină. Figura 2A arată creșterea PTB1 și PTB2 celule reduse la tăcere, demonstrând o reducere marcată a creșterii celulare la reducerea la tăcere a fiecăruia dintre acești factori. Deși creșterea ambelor PTB1 și PTB2 celulele reduse la tăcere au fost inhibate, PTB2 celulele reduse la tăcere au fost afectate mai grav. Diferența poate rezulta din efectul asupra procesării sau stabilității diferitelor subgrupuri de ARNm de către acești doi factori (a se vedea mai jos). Reducerea mARN-urilor și proteinelor corespunzătoare din celulele reduse la tăcere este prezentată în Figura 2, B și C. Rezultatele indică inducerea producției de dsRNA și o reducere cu 80% & # x02013100% a nivelului mARN-urilor corespunzătoare.

(A) PTB1 și PTB2 sunt gene esențiale. Creșterea celulelor neduse (& # x02212Tet) a fost comparată cu celulele induse pentru producția de ARNd (+ Tet). Numărul de celule din culturile neinduse este desemnat de diamantele negre numărul din culturile induse, de pătratele gri. (B) Analiza nordică a PTB1 și PTB2 după mutarea ARNi. ARN a fost preparat din celule și celule neinduse după 3 zile de inducție. ARN total (20 & # x003bcg) a fost separat pe un gel de formaldehidă 1,2% agaroză & # x020132,2 M. ARN-ul a fost șters și hibridizat cu o sondă marcată aleatoriu specifică pentru cele două gene. Nivelul de ARN 7SL (control pentru încărcare egală) a fost detectat prin hibridizare cu oligonucleotida ARN 7SL anti-sens. Este indicată identitatea transcrierilor. (C) Analiza occidentală a proteinelor PTB (stânga). Extractul de celule întregi (30 & # x003bcg) a fost separat pe 12% SDS & # x02013 poliacrilamidă și supus analizei occidentale folosind anticorpi anti-PTB (diluat 1: 10.000). Sunt indicați markeri de masă moleculară. Analiza occidentală a nivelului de proteine ​​PTB la reducere (dreapta). Extractele totale de proteine ​​din 2 & # x000d7 10 8 celule din celule neinduse și reduse la tăcere la 3 zile după inducție au fost separate pe geluri de poliacrilamidă 12% SDS și # x02013 și supuse analizei occidentale utilizând anticorpi anti-PTB1 și anti-PTB2 (diluat 1: 10.000). Nivelul hnRNP D0 a fost utilizat ca control pentru încărcare egală.

Anticorpii au fost ridicați împotriva PTB1 și PTB2, așa cum este descris în Materiale și metode, și utilizați pentru a examina reducerea nivelului de proteine ​​la reducere la zgomot. Specificitatea anticorpilor a fost examinată folosind T. brucei extracte de celule întregi, iar rezultatele din Figura 2C (panoul din stânga) arată că fiecare anticorp recunoaște doar o singură polipeptidă. La reducere la zgomot, s-a observat eliminarea completă a proteinei corespunzătoare (Fig. 2C, panoul din dreapta). Aceste rezultate sugerează că reducerea la tăcere a PTB1 și PTB2 a fost foarte eficient și că acești factori sunt esențiali pentru viață.

Localizarea celulară și fracționarea biochimică a PTB1 și PTB2

Localizarea proteinelor PTB a fost determinată prin fuzionarea PTB1 cu GFP sau prin imunofluorescență, folosind anticorpi împotriva PTB2. Rezultatele (Fig. 3A) arată imagini ale întregului parazit (expunere îndelungată) și expunere scurtă a nucleului (colțul stâng). Datele sugerează că ambele proteine ​​sunt localizate în principal în nucleu în & # x0201peckles, & # x0201d, dar s-a observat și o colorare slabă în citoplasmă.

(A) Localizarea PTB1 și PTB2 în celulă. (Superior panou) Imagistica celulelor care exprimă constructul GFP-PTB1. Celulele au fost fixate în 4% formaldehidă (panou A) fluorescența PTB1-GFP (panou b) nuclee colorate cu DAPI (c) Combinarea DIC a panourilor A și b. Imaginile au fost obținute în urma unei expuneri îndelungate. Mărirea zonei nucleare este încadrată și a fost obținută utilizând o expunere mai scurtă. (Inferior panou) Imunofluorescența PTB2. Celulele au fost fixate cu paraformaldehidă 2% timp de 25 de minute, incubate cu anticorpi așa cum este descris în Materiale și metode și detectate de un anticorp secundar conjugat cu FITC. (Panou A) Fluorescența proteinei PTB2 (panou b) nuclee colorate cu DAPI (panou c) Combinarea DIC a panourilor A și b. Imaginile au fost obținute în urma unei expuneri îndelungate. Mărirea zonei nucleare este încadrată și a fost obținută utilizând o expunere mai scurtă. (B) Fracționarea extractelor prin FPLC pentru a determina dimensiunea complexelor asociate cu proteinele PTB. Extractele de celule întregi au fost preparate din celule parentale sau din celule care exprimă proteina Prp31 marcată cu BB2 (Liang și colab. 2006). Pregătirea extractului și cromatografia pe coloană sunt descrise în Materiale și metode. Proteinele au fost supuse analizei occidentale folosind anticorpii relevanți (anti-BB2, anti PTB [acest studiu], anti-U2AF65 [furnizat cu amabilitate de Dr. Mariano Levin, Institutul de Inginerie Genetică și Biologie Moleculară (INGEBI) și Consiliul Național al Științei și Cercetare tehnologică (CONICET)]). Este indicată identitatea proteinelor examinate. Sunt indicate pozițiile de eluție ale proteinelor marker, BSA (66 kDa) și & # x003b2-amilază (200 kDa). (C) Coimmunoprecipitarea proteinelor PTB. Extractul a fost preparat din 5 & # x000d7 109 celule și imunoprecipitarea a fost efectuată cu anticorpii așa cum este descris în Materiale și metode. Probele au fost supuse analizei occidentale utilizând anticorpi PTB1 și PTB2. Proteinele imunoprecipitate cu PTB1 au fost testate cu anti-PTB2 și invers. Extractul celular total și supernatantul (5%) au fost analizate alături de margele întregi.

Am examinat apoi distribuția factorilor prin fracționarea extractelor derivate din tip sălbatic T. brucei în stadiul prociclic sau extrase din celule care poartă o proteină PRP31 marcată cu BB2 exprimată din situl său autentic (Liang și colab. 2006). Extractele au fost preparate în condiții de sare redusă (50 mM KCI) și fracționate pe o coloană Superdex S-200 FPLC. Fracțiile de vârf ale acestor factori au fost diferite (Fig. 3B) PTB1 a fost găsit mai ales în fracțiile 22 & # x0201328, în timp ce PTB2 a fost găsit în fracțiunile 24 & # x0201326. Datorită distribuției lor diferențiale, acești factori cel mai probabil nu interacționează între ei. Pentru a verifica dacă acesta este într-adevăr cazul, anticorpii la fiecare dintre aceste proteine ​​au fost folosiți în experimentele de imunoprecipitare. Rezultatele din Figura 3C demonstrează că anticorpii împotriva PTB1 imunoprecipitat PTB1, dar nu PTB2, în timp ce anticorpii împotriva PTB2 au precipitat PTB2, dar nu PTB1. Interesant este că PTB1 și PTB2 nu fracționează, de asemenea, împreună cu mai mulți dintre factorii generali de îmbinare, cum ar fi PRP31 sau U2AF65. Cu toate acestea, dimensiunea complexelor care transportă PTB1 sau PTB2 sunt în intervalul 66 & # x02013200-kDa, sugerând că acești factori sunt probabil asociați cu alți factori de îmbinare sau proteină. Cu toate acestea, complexele formate cu PTB1 și cu PTB2 sunt semnificativ mai mici decât cele asociate cu PRP31 și U2AF65.

PTB1 și PTB2 nu sunt factori de îmbinare bazali, deși reducerea la zgomot a acestora afectează nivelul de echilibru al ARN-ului SL și transcrierea sa naștentă

Am demonstrat anterior că reducerea la zgomot a factorilor de îmbinare bazală care afectează trans-plicarea tuturor ARNm-urilor are ca rezultat creșterea nivelurilor de ARN SL, deoarece nu este utilizată în splicare și, prin urmare, se acumulează în celulă (Mandelboim și colab. 2003 Liu și colab. 2004 Liang și colab. 2006 Tkacz și colab. 2007). Pentru a examina dacă proteinele PTB1 și PTB2 sunt factori de îmbinare bazală, efectul asupra nivelului de stare de echilibru al ARN-ului SL a fost examinat prin extinderea primerului după reducerea PTB. Rezultatele prezentate în Figura 4A sugerează că reducerea la zgomot a ambilor factori a redus nivelul de echilibru al ARN-ului SL cu 30% și 60% în PTB1 și PTB2 celule reduse la tăcere, respectiv. Nu s-a observat niciun efect asupra plafonării ARN-ului SL, deoarece opririle eșalonate de pe nucleotidele cap-4 au fost aceleași în celulele neduse și în celulele epuizate PTB1 sau PTB2. Pentru a examina dacă trans-plicarea este afectată în același grad ca reducerea ARN SL sau mai drastic, nivelul intermediarului structurii Y a fost examinat folosind o oligonucleotidă complementară porțiunii intronice a ARN SL. Dacă trans-implicarea este afectată la prima etapă a îmbinării nivelul structurii Y este scăzut, dar dacă reacția este afectată în a doua etapă structura Y se acumulează. Rezultatele, prezentate în Figura 4B, sugerează că reducerea nivelurilor structurii intermediare Y (39% și 58%, respectiv pentru PTB1 și PTB2) reflectă reducerea nivelului de ARN SL în stare de echilibru, sugerând că nici PTB1 sau PTB2 afectează trans-splicarea tuturor ARNm reducerea nivelului structurii Y se corelează bine cu reducerea nivelului ARN SL în celulele tăcute. Experimentele care măsoară gradul de reducere a ARN-ului SL și a structurii intermediare Y au fost repetate de trei ori, iar rezultatele acestor experimente sunt prezentate în Figura 4C. În acest moment, nu putem exclude posibilitatea ca acești factori să afecteze trans-plicarea doar a unui subset de ARNm, dar datele sugerează că nici PTB1, nici PTB2 nu sunt un factor general de splicing care afectează nivelul structurii Y intermediare. Defectele datorate silențierii PTB2 sunt mai grave decât cele observate pentru PTB1. Aceste diferențe nu pot fi atribuite diferitelor grade de tăcere, deoarece în ambele cazuri tăierea a dus la eliminarea completă a proteinelor.

Nivelurile de ARN SL și structura Y intermediare PTB1 și PTB2 tăcere. (A) Nivelul de ARN SL. ARN-ul total a fost preparat din celule care transportă constructele PTB înainte de inducție (& # x02212Tet) și după 3 zile de inducție (+ Tet). Extensia primară a fost efectuată pe 10 & # x003bcg ARN cu oligonucleotidă radiomarcată complementară cu capătul 3 & # x02032 al ARN SL (20708 listat în Tabelul suplimentar S-1). ADNc a fost separat pe un gel de secvențiere de 6%. Poziția opririlor rezultate din diferitele capacități este indicată pe stânga. Extensia primară cu U3 a fost utilizată pentru a controla cantitatea de ARN din probă. (B) Extensie de grund pentru a determina nivelul structurii Y intermediare. La fel ca în A dar s-a folosit grundul 9091 (listat în S-1). (C) Analiza cantitativă a ARN-ului SL și a structurii Y intermediare PTB tăcere. Nivelul structurii SL ARN și Y din celulele neinduse este prezentat în bare gri, iar aceleași valori derivate din trei experimente de tăcere independente sunt date în bare albe, se arată abaterea standard.

În continuare am examinat dacă reducerea nivelului de ARN SL în timpul silențierii rezultă din oprirea transcripției ARN SL. În acest scop, a fost utilizat un sistem de celule permeabile (Tschudi și Ullu 1990 Ullu și Tschudi 1990). ARN-ul SL este transcrierea radiomarcată majoră în acest sistem. Rezultatele din Figura 5 indică reduceri cu 54% și 79% ale nivelului de ARN SL nou transcris ca urmare a PTB1 și PTB2 tăcere, respectiv.

Transcriere nascentă în PTB1 celule reduse la tăcere și PTB2 celule reduse la tăcere. Celulele permeabile au fost preparate din același număr de celule neduse și tăcute PTB în a treia zi de tăcere, așa cum este descris în Materiale și metode. ARN-ul marcat a fost fracționat pe un gel denaturant de 6%. Sunt indicate identitățile ARN-urilor. O expunere mai scurtă a ARN-ului SL este afișată pe dreapta.

Efectul proteinelor PTB asupra nivelului ARN-ului SL poate rezulta fie dintr-un efect direct, fie dintr-un efect indirect. De exemplu, proteinele PTB pot interacționa cu promotorul sau cu complexul de transcripție ARN SL. Proteinele PTB se pot lega, de asemenea, de ARN-ul SL născut înainte de asamblarea acestuia cu proteinele Sm și astfel afectează stabilitatea ARN-ului SL născut. Alternativ, efectul asupra transcripției ARN SL ar putea fi un efect indirect și una dintre proteinele care sunt esențiale pentru transcripția ARN SL poate fi codificată de un ARN de scurtă durată al cărui nivel este reglat (redus) în celulele silențioase PTB.

Pentru a detecta posibila legare directă a PTB la promotorul ARN SL, s-a efectuat un test ChiP folosind anticorpi la proteinele PTB. Rezultatele (datele neprezentate) sugerează că PTB nu se asociază direct cu ADN-ul promotorului SL. Am examinat apoi dacă reducerea nivelului nașterii de ARN SL poate fi rezultatul legării acestor proteine ​​la ARN-ul naștent SL, prin reticulare UV in vitro a proteinei PTB1 la ARN SL sintetizat în celule permeabile. Rezultatele (datele neprezentate) sugerează că nu se poate observa o astfel de reticulare atunci când au fost utilizate extracte de celule întregi. Aceste rezultate sugerează că efectul PTB asupra nivelurilor de ARN SL nu este probabil primar și poate rezulta din reglarea descendentă a unui factor, încă neidentificat, care funcționează fie în transcrierea ARN SL, fie în stabilizarea ARN SL naștere.

Analiza microarray a ARN-ului izolat din celulele silențioase PTB1 și PTB2 sugerează efecte diferențiale asupra transcriptomului

Deoarece rezultatele prezentate în Figura 4 sugerează că nici PTB1, nici PTB2 nu sunt un factor general de îmbinare care afectează îmbinarea tuturor ARNm, am căutat să identificăm care ARNm sunt afectate în mod specific și diferențiat în celulele epuizate pentru PTB1 sau PTB2. ARN-ul a fost preparat din celule după 3 zile de tăcere și a fost comparat cu ARN-ul din celulele neduse.

Au fost efectuate trei replici biologice și hibridizate la T. brucei microarrays descrise în Materiale și metode. Datele au fost analizate folosind software-ul GeneSpring GX (Agilent Technologies). Normalizarea Lowess a fost efectuată pentru a corecta tendința de colorare, iar datele normalizate au fost utilizate pentru a identifica gene a căror expresie părea să fie semnificativă (P value & # x0003c0.05) în sus sau în jos, cu o tăiere arbitrară de cel puțin 1,5 ori. O listă cu astfel de gene este furnizată în Tabelul suplimentar S-2. Pentru a vizualiza diferențele în expresia genelor în PTB celule silențioase, gruparea ierarhică de legătură medie a fost efectuată pe genele selectate utilizând corelația Pearson ca măsură de similitudine și s-a construit o hartă de căldură reprezentând diferența de nivel a transcrierilor dintre celulele neinduse și celulele silențioase (Fig. 6). Rezultatele demonstrează că PTB1 și PTB2 afectează diferențial transcriptomul, sugerând că aceste proteine ​​leagă diferite subseturi de ARNm.

Harta de căldură a genelor care sunt exprimate diferențial între celulele PTB1 și PTB2 reduse la tăcere față de celulele neinduse. Transcrieri care diferă de control prin & # x0003e1,5 ori schimbare (P valoare & # x0003c0.05) au fost alese pentru analiză. Fiecare coloană reprezintă media a trei replici biologice. Harta de căldură a fost generată utilizând software-ul Genspring GX (tehnologii Agilent) folosind algoritmul de grupare ierarhică a legăturii medii și corelația Pearson ca măsură de similaritate. Diagrama reprezintă nivelul de expresie diferențială conform următoarei scări de culoare: roșu, gene reglate în sus albastru, gene reglate în jos.

Deoarece PTB1 și PTB2 afectează nu numai splicarea, ci și stabilitatea ARNm (vezi mai jos), lista genelor reglementate a fost examinată pentru prezența secvențelor bogate în tracturi de polipirimidină în secvențe care flancează secvența codificatoare atât la capetele 5 & # x02032, cât și la 3 & # x02032 al ORF. În acest scop, secvențe de 300 bp în amonte și 500 bp în aval ale fiecărei gene au fost recuperate din GeneDB utilizând instrumentul de descărcare & # x0201clist & # x0201d (http://www.genedb.org). Căutarea a fost efectuată folosind un program de limbaj C scris în interior (disponibil de la autori la cerere).

Programul a fost conceput pentru a căuta trei tipuri de secvențe: (1) secvențe care poartă un tract optim de polipirimidină (ca semnal de îmbinare), definit ca o întindere de cel puțin zece T cu doar un C permis (Benz și colab. 2005) ( 2) tractele polipirimidinice care transportă întinderi de T și C, unde T este mai abundentă și conțin, de asemenea, situsuri de legare PTB (TCTT și / sau TCTCT) și (3) tracturi polipirimidine neoptimale (ca semnale de îmbinare) care nu au secvențe PTB, și în care T cuprinde cel puțin 59% din secvență (Benz și colab. 2005). O sută șaptezeci de gene s-au dovedit a fi reglate în jos și 146 de gene reglate în sus de peste 1,5 ori în celulele cu tăcere PTB1 comparativ cu martorul. Dintre acestea, 49 din genele reglate în jos și 36 din genele reglate în sus poartă un site neconvențional al tractului polipirimidinic (PPT) care conține un situs de legare PTB în regiunea lor din amonte și sunt prezentate în tabelul suplimentar S-3. 150 de gene au fost reglate în jos și 214 de gene au fost reglate în sus de mai mult de 1,5 ori în celulele cu tăcere PTB2 comparativ cu martorul. Dintre aceste gene, 46 din genele reglate în jos și 51 din genele reglate în sus nu au un site PPT canonic, care să conțină secvențe de legare PTB în regiunea lor din amonte și sunt prezentate în tabelul suplimentar S-4. Genele enumerate în tabelele suplimentare S-3 și S-4 sunt cel mai probabil gene care sunt reglate la nivelul de îmbinare, în timp ce transcrierile rămase sunt cel mai probabil reglementate la nivelul stabilității ARNm (vezi mai jos). Pentru a examina dacă transcrierile sunt reglementate atât de PTB1, cât și de PTB2, s-a pregătit o diagramă Venn, rezultatele indicând nicio suprapunere semnificativă între transcrierile reglementate de cele două proteine ​​PTB (date neprezentate), sugerând că fiecare factor se leagă de un subset diferit de transcrieri .

Validarea datelor microarray

Pentru a valida rezultatele obținute de Microarray, au fost selectate mai multe transcrieri din lista din Tabelul suplimentar S-2 al potențialelor substraturi PTB1 și PTB2 care sunt fie reglate în sus, fie în jos. ADNc a fost preparat din ARN folosind primeri aleatori. Cantitatea de ARN din fiecare probă a fost calibrată prin examinarea nivelului de tubulină, un transcript al cărui nivel nu a fost modificat în celulele tăcute cu PTB. Candidații au fost selectați în funcție de modificările lor de ori în timpul silențierii (mai mult de 2,3 ori) și au fost analizate doar mARN-uri abundente (pe baza intensității hibridizării în experimentele cu microarray). De asemenea, am preferat să alegem gene care au o adnotare clară în genom. Rezultatele din Figura 7A rezumă validarea a cinci transcrieri reglementate în sus și patru transcrieri reglementate în jos PTB1 celule silențioase, iar cele din Figura 7B rezumă patru transcrieri reglementate în sus și # x02013 și cinci transcrieri reglementate în jos în PTB2 celule reduse la tăcere. Aceste rezultate confirmă faptul că datele microarray-ului reflectă într-adevăr modificările adevărate ale transcriptomului ca urmare a silențierii PTB și că aceste transcrieri sunt fie reglate în jos, fie reglate în sus ca urmare a PTB epuizare. Pentru a demonstra specificitatea efectului asupra acestor transcrieri distincte, nivelul substraturilor PTB1 a fost examinat în celulele silențioase PTB2 și invers. Rezultatele indică faptul că mutarea fiecăreia dintre proteinele PTB a afectat în mod specific un subset unic de transcrieri, susținând din nou noțiunea că acești factori acționează pe diferite substraturi.

Validarea datelor microarray prin RT-PCR. ADNc a fost preparat din ARN total (1 & # x003bcg) derivat din celule neinduse (& # x02212Tet) sau celule după 3 zile de tăcere (+ Tet), așa cum este descris în Materiale și metode. O alicotă a ADNc (1/50 până la 1/100) a fost amplificată prin PCR folosind primeri specifici genei (enumerați în tabelul suplimentar S-1). Reacția PCR a fost analizată pe geluri de agaroză 1% și vizualizată prin colorare cu bromură de etidiu. Cantitatea de ADNc a fost calibrată prin măsurarea cantității de tubulină din probă. Pentru fiecare reacție, am determinat liniaritatea amplificării prin diluarea ADNc. Genele prezentate sunt acelea care au fost în mod semnificativ reglate în sus sau în jos în timpul silențierii (de cel puțin 2,3 ori în datele microarray). Ca control, nivelul acestor transcrieri a fost examinat în ARN extras din celule reduse la tăcere pentru celălalt PTB. (A) Gene reglate în sus și reglate în jos în PTB1 celule tacute (B) ca în A, dar pentru PTB2 celule reduse la tăcere. Sunt prezentate numărul de aderare și adnotarea fiecărei gene, pe baza GeneDB.

Apoi, am examinat dacă reglarea în jos sau în sus este un rezultat direct al legării acestor factori la mARN-urile corelate. Legarea PTB a fost examinată prin imunoprecipitarea transcrierilor folosind anticorpi la PTB1 și PTB2. Pentru a stabiliza interacțiunile ARNm & # x02013proteine, celulele au fost expuse la iradiere UV, extracte au fost preparate din celule, iar ARN-ul imunoprecipitat a fost supus RT-PCR pentru a detecta transcrierile relevante. Ca control, s-a folosit ser preimun. Rezultatele prezentate în Figura 8 demonstrează legarea selectivă a PTB1 (Fig. 8A) și PTB2 (Fig. 8B) la transcrierile înrudite ale căror niveluri s-au schimbat în timpul tăcerii. Dintre genele testate, trei s-au dovedit a fi fals pozitive în două din cele trei (Tb927.4.5390 și Tb927.6.2640), modificările lor în timpul epuizării nu au fost confirmate de RT-PCR. Pentru a verifica specificitatea legării, substraturile PTB1 au fost examinate printre ARNm imunoprecipitați de anticorpii anti-PTB2 și invers. Rezultatele demonstrează specificitate completă, deoarece niciun substrat PTB1 nu a fost imunoprecipitat folosind anticorpi anti-PTB2 și invers.

Identificarea substraturilor PTB1 și PTB2 prin imunoprecipitare cu anticorpi înrudiți. Extractul de celule întregi a fost preparat din 5 și # x000d7 10 9 celule parentale după 5 minute de reticulare UV, așa cum este descris în Materiale și metode. Imunoprecipitarea a fost efectuată cu ser anti-PTB1, anti-PTB2 sau control-preimun. ARN-ul a fost eluat din margele și, împreună cu ARN-ul total (de intrare), a fost analizat prin RT-PCR. Primerii utilizați pentru amplificarea genelor specifice sunt enumerați în Tabelul suplimentar S-1. Sunt prezentate numărul de aderare și adnotarea genelor bazate pe GenDB. Ca martor, substraturile PTB2 au fost examinate în mARN-urile imunoprecipitate PTB1 și invers aceste transcrieri de control sunt marcate cu asteriscuri.

Pentru fiecare transcriere, modificarea nivelului de ARNm poate proveni din unul sau mai multe mecanisme. PTB poate afecta transcripția ARNm, stabilitatea ARNm sau îmbinarea pre-ARNm. O scădere a nivelului transcrierii în celulele silențioase poate sugera că PTB este esențial pentru transcriere, îmbinare sau stabilizare a transcrierii. Cu toate acestea, nu putem exclude posibilitatea ca nivelul transcrierilor să fie afectat și de efecte secundare. De exemplu, una dintre țintele PTB poate fi în sine o proteină de legare a ARN-ului care afectează nivelul altor substraturi. Cu toate acestea, nu există nicio potrivire exactă cu secvențele prezente în constructul de reducere a zgomotului care ar putea reduce la tăcere o altă genă decât genele PTB și, prin urmare, să genereze un efect în afara țintei.

Deși reglarea transcripțională (la nivel de inițiere) nu pare să joace un rol major în reglarea genelor în tripanosomi, PTB mutarea a afectat transcrierea ARN-ului SL. Prin urmare, a fost de interes să analizăm efectul PTB silențiere pe transcrierea genelor care codifică proteinele și se compară cu transcrierea genelor care nu codifică proteinele transcrise de polimeraza I sau III. PTB se poate lega de ADN și poate afecta alungirea transcripției. Pentru a examina dacă PTB mutarea afectează transcrierea, ARN nașterea sintetizată în celule permeabile a fost utilizată pentru a testa pete de slot care transportă produse PCR ale transcrierilor care au demonstrat niveluri modificate în celulele cu tăcere PTB. Rezultatele (Fig. 9) arată că în ambele PTB1 celule reduse la tăcere (Fig. 9A) și PTB2 celulele silențioase (Fig. 9B), efectul asupra transcrierii nașterii a ARNm care codifică proteina a fost foarte modest în comparație cu efectul său asupra transcripției ARN SL. Rețineți că nu s-a observat nicio modificare a transcrierii pentru transcrierile ale căror niveluri au fost ridicate în timpul silențierii (marcate cu săgeți). Rezultatele demonstrează, de asemenea, că oprirea transcripției este cel mai probabil specifică pentru polimeraza II, deoarece efectul cel mai semnificativ a fost observat pentru transcrierile polimerazei II și nu s-a observat niciun efect asupra transcrierii ARNr (transcris de polimeraza I) sau U2 snRNA, care este transcris în tripanosomi de polimeraza III (Nakaar și colab. 1994). Cu toate acestea, nu putem exclude posibilitatea ca PTB să se lege de anumite secvențe de ADN de-a lungul genomului și să afecteze alungirea transcripției unor astfel de loci. Cu toate acestea, nu am putut detecta astfel de loci în ecranul nostru limitat pentru substraturi PTB.

Sinteza ARN nascent în PTB1 și PTB2 celule reduse la tăcere. Celulele permeabile au fost preparate din celule neinduse (& # x02212Tet) și celule după 3 zile de tăcere PTB1 și PTB2 (+ Tet) așa cum este descris în Materiale și metode. ARN-ul a fost utilizat pentru hibridizare cu un slot de tip slot care conține ADN care codifică genele, după cum sa indicat. (A) PTB1 (B) PTB2. Identitatea genelor este dată de numărul de acces. Ca martor, a fost utilizată gena SIRT la mamifere. Genele reglate în sus bazate pe matrice sunt indicate de săgeți.

PTB1 și PTB2 afectează stabilitatea seturilor distincte de ARNm

La mamifere, s-a demonstrat că PTB guvernează stabilitatea ARNm prin legarea la 3 & # x02032 UTR (Soderberg și colab. 2002 Kosinski și colab. 2003 Tillmar și Welsh 2004). Pentru a examina dacă PTB1 și PTB2 reglează în mod similar stabilitatea substraturilor lor, s-a examinat timpul de înjumătățire al transcrierilor țintă PTB1 și PTB2. Au fost selectate două ținte PTB1: AATP11 (Tb927.4.4730), care codifică un transportor de aminoacizi a cărui expresie este reglată în jos după reducerea PTB și un transcript care codifică o proteină ipotetică, HP2690 (Tb11.01.2690), al cărui nivel este reglat în sus în timpul tăcerii (Fig. 7A). Pentru PTB2, au fost selectate următoarele transcrieri: AQP3 codificarea unui canal de apă aquaporin (Tb927.6.1520), care este reglat în jos și PDE (piruvat dehidrogenază Tb10.389.0890) al cărui nivel este reglat în sus PTB2-celule silențioase (Fig. 7B). Pentru a măsura timpul de înjumătățire al ARNm în timpul tăcerii, celulele neduse și celulele la 3 zile după inducție au fost concentrate. După câteva minute de recuperare, celulele au fost tratate cu sinefungină, care s-a dovedit a inhiba trans-splicarea și pentru a ajuta la închiderea producției de ARNm, prin urmare, acest agent îmbunătățește calitatea experimentelor care determină timpul de înjumătățire al ARNm (Colasante și colab. 2007). Sinefungin a fost adăugat la celule timp de 10 min, apoi s-a adăugat actinomicină D și ARN a fost extras din celule la momentele indicate. Analiza nordică a fost efectuată folosind sondele indicate.Aceleași membrane au fost hibridizate cu o sondă specifică ARN-ului 7SL. Nivelul ARNm a fost măsurat prin densitometrie, iar timpul de înjumătățire a fost calculat normalizându-se la nivelul ARN 7SL. După cum se poate vedea în Figura 10A, timpul de înjumătățire plasmatică al AATP11 ARNm a scăzut de la 43 la 22 de minute, în timp ce timpul de înjumătățire plasmatică al HP2690 a fost crescut de la 10 la 100 de minute în celulele cu tăcere PTB1. Timpul de înjumătățire al AQP3 a scăzut de la 80 min la 20 min, iar cel al PDE a fost crescut de la 40 min la 75 min în celulele cu tăcere PTB2 (Fig. 10B). Rezultatele din Figura 10 au fost repetate de trei ori și fiecare punct de timp este prezentat cu abaterea standard corespunzătoare. Aceste rezultate sugerează că ambele proteine ​​PTB afectează stabilitatea ARNm fie prin stabilizarea, fie prin destabilizarea lor. Interesant este faptul că se schimbă AATP11 nivelurile din celulele reduse la tăcere depășesc modificarea observată în timpul de înjumătățire plasmatică al ARNm corespunzător, sugerând că PTB își poate exercita reglarea asupra acestui transcript prin mecanisme suplimentare (vezi mai jos).

PTB1 și PTB2 reglează timpul de înjumătățire al ARNm. Analiza nordică a nivelurilor de ARNm. Celulele neduse și epuizate cu PTB1 (3 zile după inducție) au fost tratate cu sinefungină (2 și # x003bcg / ml) și, după 10 minute, cu Actinomicină D (30 și # x003bcg / ml). ARN-ul a fost preparat în punctele de timp indicate deasupra benzilor, separat pe un gel de 1,2% agaroză și # x02013formaldehidă și supus analizei nordice cu sondele specifice genei indicate. ARN 7SL a fost utilizat pentru a controla încărcarea egală. (A) PTB1 (B) PTB2. Semnalele de hibridizare prezentate în superior au fost măsurate prin densitometrie. Curbele de descompunere sunt prezentate sub pete, iar timpul de înjumătățire este ilustrat de liniile întrerupte. Decăderea în absența inducției (& # x02212Tet) este indicată de diamante negre la inducție (+ Tet), de pătrate gri.

Aceste rezultate arată că transcrierile sunt afectate diferențial, amplitudinea reglării variind de la o diferență de două până la 10 ori. Cu toate acestea, proteinele PTB1 și PTB2 ar trebui să recunoască un domeniu PPT îmbogățit cu site-uri de legare PTB, astfel încât transcrierile corelate sunt de așteptat să conțină astfel de site-uri și ar trebui să existe un site care leagă consensul. Pentru a căuta astfel de secvențe, a fost efectuată o aliniere multiplă folosind ClustalW (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_server.html). Pentru analiză au fost alese serii de 41 de transcrieri care conțin secvențe PPT care au fost afectate în celulele silențioase PTB1 și 98 de transcrieri care au fost afectate în celulele silențioase PTB2. Deoarece aceste site-uri de legare au fost ușor detectate la 3 & # x02032 UTR, doar 3 & # x02032 UTR secvențe au fost utilizate pentru a genera setul de date. Alinierea secvenței este prezentată în tabelul suplimentar S-5. Secvențele evidențiate conțin unul sau două site-uri de legare PTB încorporate în PPT.

PTB1 și PTB2 sunt esențiale pentru trans-implicarea transcrierilor care transportă tracturi polipirimidinice bogate în C

Așa cum s-a indicat mai sus, transcrierile, cum ar fi AATP11, au fost reglate în jos dincolo de efectele care ar putea fi atribuite stabilității ARNm, sugerând că PTB poate funcționa și la nivelul de splicing. Această observație ne-a determinat să inspectăm 5 & # x02032 UTR de gene care au fost reglementate în jos ca urmare a PTB1 sau PTB2 tăcere. Am identificat transcrieri care nu au un PPT consens, având în principal U, dar care posedă site-uri PTB care sunt bogate în C. Au fost alese șase transcrieri, iar situl lor de îmbinare AG a fost determinat prin amplificarea ARNm specific utilizând RT-PCR cu un primer anti-simț situat aproape de primul primer de sens AUG și SL. Secvența din amonte la situl de îmbinare AG a șase gene este prezentată în Figura 11A, PPT presupus sunt încadrate și cursive. Inspecția secvențelor sugerează că în aceste transcrieri, distanța dintre AG și PPT este de 10 & # x0201360 nucleotide (nt), care, în majoritatea cazurilor, este mai mare decât media de 25 nt observată anterior (Benz et al. 2005). Raportul U / C este de 1,52 comparativ cu 2 găsit în majoritatea transcrierilor (Benz și colab. 2005). În plus, un site de legare PTB a fost găsit încorporat în fiecare dintre site-urile PPT. Pentru a examina dacă trans-Splicarea acestor transcrieri este afectată în PTB silențios, nivelurile maturii și pre-ARNm au fost determinate la tacerea PTB prin RT-PCR. Deoarece U2AF65 se leagă de site-urile PPT (Zamore și colab. 1992), a fost de interes să se determine dacă trans-plicarea acestor transcrieri PPT bogate în C depinde și de prezența U2AF65. The T. brucei U2AF65 a fost descris recent și este mai mare decât omologul său la mamifere. Interacționează cu SF1, dar nu cu U2AF35 și afectează primul pas al trans-reacție de îmbinare (Vazquez și colab. 2009). În acest scop, trans-Splicarea celor șase transcrieri a fost examinată în PTB1 celule reduse la tăcere, PTB2 celule reduse la tăcere și U2AF65 celule reduse la tăcere. Rezultatele (Fig. 11B) sugerează că în cinci dintre transcrieri, trans-implicarea a fost perturbată în PTB1 celule reduse la tăcere sau PTB2 celule tacute, sugerând că trans-plicarea acestor transcrieri depinde de prezența PTB1 sau PTB2. Pentru a controla specificitatea și cantitatea de ARN utilizat în reacții, am utilizat mRNA de tubulină ca control, deoarece nivelul acestui transcript nu se schimbă după reducerea nivelului de PTB1 sau PTB2. Pentru U2AF65, nivelul de ARN 7SL a fost utilizat pentru normalizare, deoarece U2AF65 este un factor general de îmbinare care afectează trans-plicarea tuturor genelor. Rezultatele din Figura 11 sugerează, prin urmare, că proteinele PTB funcționează în plus față de U2AF65 și nu în locul lui, de atunci trans-plicarea acelorași șase transcrieri a necesitat prezența U2AF65 funcțional pentru corect trans-implicare.

Analiza genelor a căror trans-splicarea este reglată de proteinele PTB. (A) Se indică secvența din amonte către situl de îmbinare AG, iar secvențele AG sunt îngroșate și subliniate, secvența PPT cursivă și încadrată, iar site-urile de legare PTB supuse în cadrul secvențelor PPT sunt aldine. Sunt indicate numărul de acces și reglarea fie prin PTB1, fie prin PTB2. (B) RT-PCR pentru a determina nivelul pre-ARNm și ARNm matur sub PTB1, PTB2, și U2AF65 tăcere. ADNc a fost preparat din celule neinduse sau din celule după 3 zile de tăcere. Calibrarea cantității de ADNc a fost efectuată folosind gena tubulinei. RT-PCR a fost efectuat așa cum este descris în Materiale și metode. Primerii utilizați pentru a amplifica pre-ARNm și ARN matur sunt enumerați în Tabelul suplimentar S-1. Produsele PCR au fost separate pe geluri de agaroză 1% și colorate cu bromură de etidiu. Sunt date numerele de aderare ale genelor. Ca control pentru cantitatea de ADNc din fiecare probă, cantitatea de tubulină a fost determinată pentru ARN din PTB1 și PTB2 celule reduse la tăcere și cantitatea de ARN 7SL din ARN din celule U2AF65 reduse la tăcere.

Deoarece la mamifere, PTB este un represor de îmbinare, am căutat în setul de date de gene reglate în sus pentru gene care poartă un site PPT bogat în C. O astfel de transcriere (numărul 6 din listă, Tb11.01.3580) a fost identificată și, într-adevăr, mutarea PTB1 îmbunătățit trans-splicing, sugerând că PTB1 poate servi fie ca un represor de splicing, fie ca activator. Pot exista multe mai multe astfel de transcrieri printre transcrierile care au site-uri de legare PTB în PPT-ul lor și al căror nivel este reglat în sus în timpul silențierii.

Identificarea AATP11 Siturile de legare PTB1 in vivo și in vitro

Pentru a verifica dacă PTB se leagă de site-urile de legare supuse indicate în Figura 11A, AATP11 substratul a fost utilizat pentru analize ulterioare. Studii recente sugerează că această genă este extrem de exprimată în stadiul prociclic al parazitului și este reglată prin stabilitatea ARNm, dictată de secvențe prezente în 3 & # x02032 UTR a genei (Robles și Clayton 2008). Secvența de AATP11 și poziția PPT în raport cu situl de îmbinare AG sunt prezentate în Figura 12A (EST <"tip": "întrez-nucleotidă", "attrs": <"text": "AF009707", "term_id": "2735809" >> AF009707). A fost efectuat un test de protecție RNase pentru examinare trans-deplecarea defectelor de AATP11 în PTB1 celule reduse la tăcere. Rezultatele (Fig. 12B, panoul c) demonstrează acumularea precursorului și reducerea la maturitate AATP11 ca urmare a amortizării PTB1.

Analiza in vivo și in vitro a AATP11, o genă a cărei îmbinare este reglată de PTB1. (A) Reprezentarea schematică a AATP11 transcriere. Îmbinarea AG și PPT sunt subliniate. Substituțiile de bază introduse în PPT sunt indicate cu săgeți. (B) Protecția RNase a AATP11 transcriere. Reprezentarea schematică a sondelor utilizate pentru protecția RNase a celor prematuri și maturi AATP11 transcrieri. (Panou A) Sonda utilizată pentru protejarea transcriptului de tip sălbatic este indicată dimensiunea așteptată în nucleotide ale maturității și fragmente protejate de precursori. (Panou b) Reprezentarea schematică a sondei utilizate pentru protejarea AATP11 5 & ​​# x02032 unitate de reglare fuzionată cu gena luciferazei. Sunt indicate dimensiunile fragmentelor mature și protejate. (Panou c) Fragmente protejate de AATP11 transcriere de tip sălbatic. ARN-ul a fost supus protecției RNazei așa cum este descris în Materiale și metode, iar produsele au fost separate pe un gel de uree cu acrilamidă 6% și # x020137 M. Sunt prezentate fragmentele protejate din celulele neduse (& # x02212Tet) și celulele după 3 zile de inducție (+ Tet) a PTB1. P indică sonda C, martor (nu s-a adăugat ARN la amestecul de digestie RNază) și M, marker (pBR322 MspI digest marcat la capăt). Sunt indicate pozițiile precursorului și AATP11 matur. (Panou d) Protecția RNase a transcripției fuzionate AATP11-luciferază. ARN a fost preparat din paraziți transgenici care exprimă gena luciferazei din unitatea de reglare AATP11 5 & # x02032 (pNS21b). Expresia a fost monitorizată în celulele PTB1 după 3 zile de tăcere. Fragmentele protejate au fost separate pe un gel de uree cu acrilamidă 6% & # x020137 M. O expunere mai lungă a fragmentului protejat este prezentată și indicată de săgeți. P indică sonda C, martor (nu s-a adăugat ARN la testul de protecție RNază). (Panou e) Protecția RNase pe transcripția fuzionată AATP11-luciferază care poartă o mutație PPT. La fel ca în d dar ARN-ul a fost preparat din celule purtătoare de mutație PPT. (C) Proteine ​​care devin încrucișate pentru AATP11 transcriere și la transcrierea care prezintă mutații în site-ul PPT. (Dreapta panou) Cross-reticularea a fost efectuată așa cum este descris în Materiale și metode, folosind extracte de celule întregi în prezența unor cantități crescânde de transcriere AATP-11 necomercializată, non-radioactivă. (Lane 1& # x020134) Cantități crescânde de AATP-11 de tip sălbatic neetichetat (0, 50, 100, respectiv 200 ng) (benzi 5& # x020138) cantități în creștere de AATP-11 neetichetat, non-radioactiv care poartă mutația PPT (respectiv 0, 50, 100, 200 ng) (banda 9) reticulare cu PTB1 recombinant. (Stânga) Analiza occidentală. Materialul reticulat a fost supus analizei occidentale cu anticorpi anti-PTB1. (Bandă 1) Reticulare utilizând proteină recombinantă (50 ng) (banda 2) reticulare folosind extract de celule întregi. Este indicată mărimea markerului proteic.

Apoi, secvențele de flancare 5 & # x02032 ale AATP11 au fost clonate în vectorul pNS21b (64 nt de 5 & # x02032 UTR) cu un suplimentar de 260 nt în amonte de situl de îmbinare AG, care transportă semnalele esențiale pentru trans-plicarea genei. Prin urmare, vectorul conține o genă luciferază, a cărei expresie depinde de secvențele flancante 5 & # x02032 ale AATP11 gena (Fig. 12B, panoul b). Transcrierea este exprimată de la puternicul promotor EP (Siegel și colab. 2005), iar secvențele 3 & # x02032 UTR sunt derivate din gena EP. Deoarece transcrierea fuzionată nu are autenticul 3 & # x02032 UTR al genei AATP11, efectul asupra expresiei observat în acest studiu depinde numai de legarea PTB la AATP11 Site PPT.

Pentru a verifica dacă secvența prezintă 10 nt în amonte de situl de îmbinare AG și care transportă site-ul de legare PTB este într-adevăr site-ul care guvernează reglementarea de îmbinare a AATP11 de către PTB1, C-urile din acest site au fost convertite în U-uri distrugând astfel site-urile de legare PTB. Structura constructului este prezentată în Figura 12B, panoul b, iar locația mutațiilor introduse în site-ul PPT este prezentată în Figura 12A. Paraziții transgenici care poartă gena reporter, precum și tulpina & # x02013loop construiesc la tăcere PTB1 au fost generate. Prelucrarea AATP11 transcript-fuzionat la luciferază a fost examinat prin protecția RNase. Rezultatele prezentate în Figura 12B, d, demonstrează că, la fel ca gena de tip sălbatic, AATP11-splicarea gluciferazei a fost dependentă de PTB1, deoarece în celulele reduse la tăcere s-a observat o reducere a ARN-ului matur și acumularea de precursori. Cu toate acestea, reglarea de către PTB1 s-a pierdut în celulele care transportă tractul PPT mutat, de când s-a mutat AATP11 transcrierea nu a arătat nicio dependență de PTB1 pentru îmbinare (Fig. 12B, e). De fapt, nivelurile de ARNm nu au fost reduse, ci ușor crescute. Aceste date sugerează că PPT care poartă site-ul de legare PTB și bogat în C sunt într-adevăr site-urile de legare care conferă reglementări PTB1 AATP11.

Pentru a examina legarea directă a PTB la AATP11 substrat, pre-ARNm a fost incubat fie cu PTB1 recombinant, fie cu extract de celule întregi și expus la reticulare UV. După digestia RNazei, radioactivitatea rămâne asociată numai cu proteinele care au fost legate de ARN-ul marcat. Rezultatele unui astfel de experiment sunt prezentate în Figura 12C. Una dintre proteinele cu care s-a legat încrucișat AATP11 este PTB1, deoarece o proteină care migrează cu aceeași greutate moleculară ca PTB1 recombinantă a fost identificată atunci când pre-ARNm a fost reticulat cu proteinele prezente în extractul celular întreg. Identificarea benzii PTB1 în extractul de celule întregi a fost verificată prin analiza Western (Fig. 12C, panoul din stânga). În plus, legătura încrucișată cu această proteină (marcată cu o săgeată) a fost redusă când a fostAATP11 a fost adăugat la reacție (reducere la legare de 24% la adăugarea unui exces de 200 molari de ARN nemarcat), dar nu atunci când a fost mutat nemarcat AATP11, lipsită de site-urile PTB, a fost utilizată pentru concurență (reducerea la legarea de 85% la adăugarea unui exces de 200 molari de ARN nemarcat) (Fig. 12C). Aceste rezultate arată în mod clar legarea directă a PTB la AATP11 substrat la locul propus de legare PTB1. Rețineți că o astfel de legare la AATP11 a fost, de asemenea, detectat atunci când anticorpii anti-PTB1 au fost folosiți pentru imunoprecipitarea substraturilor PTB (Fig. 8A).

PTB1 dar nu PTB2 este esențial pentru cis-implicare

Deoarece s-a arătat că PTB afectează cis-splicarea la mamifere și sa arătat nu numai că se leagă de PPT în amonte de situl de îmbinare 3 & # x02032, ci și de regiunea sitului de îmbinare 5 & # x02032, am examinat dacă PTB este, de asemenea, esențial pentru cis-implicare. În acest scop, două substraturi cunoscute care suferă cis-splicarea a fost examinată. Rezultatele din Figura 13 demonstrează prin RT-PCR (folosind tubulină pentru a controla cantitatea de ARN) că îmbinarea ambelor polimeraze poli A (PAP) și ARN helicază DEAD / H dependentă de ATP (ADRH) au fost afectate în celulele reduse la tăcere, deoarece la ambele gene s-a observat reducerea ARN-ului matur, cu acumularea clară a precursorului. Inspecția PPT a acestor gene sugerează că siturile lor sunt convenționale. Prezența unui site de legare PTB a fost observată fie în apropierea sitului de îmbinare 5 & # x02032, în cazul PAP, sau în mai multe poziții în intron, în cazul ADRH (vezi Tabelul suplimentar S-6). Interesant, niciun efect asupra cis-splicarea a fost observată în celulele cu tăcere PTB2 (Fig. 13).

Cis-implicarea poli A polimerazei (PAP) și helicaze de ARN DEAD / H dependente de ATP (ADRH) este reglementat de PTB1, dar nu de PTB2. Niveluri de precursor PAP și ADRH și mARN matur detectate de RT-PCR. ADNc a fost preparat așa cum este descris în Materiale și metode. ADNc a fost utilizat pentru analiza PCR cu primerii enumerați în tabelul suplimentar S-1. Reprezentarea schematică a primerilor utilizați în reacție și a produselor PCR așteptate sunt ilustrate pe stânga. Reacțiile PCR au fost analizate pe un gel de agaroză 1%. (Stânga) Analiza celulelor tăcute PTB1. ADNc din celulele neduse (& # x02212Tet) și ADNc din celulele PTB1 reduse la tăcere la 3 zile după inducție (+ Tet). (Dreapta) Analiza celulelor silențioase PTB2. ADNc din celulele neduse (& # x02212Tet) și ADNc din celulele PTB2 reduse la tăcere la 3 zile după inducție (+ Tet). Nivelul transcrierii tubulinei a fost utilizat pentru a controla cantitatea de ADNc din fiecare probă.


Degradare

ARNm diferiți din cadrul aceleiași celule au durate de viață distincte (stabilități). În celulele bacteriene, mARN-urile individuale pot supraviețui de la câteva secunde la mai mult de o oră. Cu toate acestea, durata medie de viață este cuprinsă între 1 și 3 minute, făcând ARNm bacterian mult mai puțin stabil decât ARNm eucariot. & # 9124 & # 93 În celulele mamiferelor, durata de viață a ARNm variază de la câteva minute până la zile. & # 9125 & # 93 Cu cât stabilitatea unui ARNm este mai mare, cu atât mai multe proteine ​​pot fi produse din acel ARNm. Durata de viață limitată a mARN permite unei celule să modifice rapid sinteza proteinelor ca răspuns la nevoile sale în schimbare. Există multe mecanisme care duc la distrugerea unui ARNm, dintre care unele sunt descrise mai jos.

Degradarea ARNm procariotă

În general, la procariote durata de viață a ARNm este mult mai scurtă decât la eucariote. Procariotele degradează mesajele utilizând o combinație de ribonucleaze, inclusiv endonucleaze, 3 'exonucleaze și 5' exonucleaze. În unele cazuri, molecule mici de ARN (ARNm) de zeci până la sute de nucleotide pot stimula degradarea mARN-urilor specifice prin asocierea bazelor cu secvențe complementare și facilitând clivajul ribonucleazei prin RNaza III. Recent s-a arătat că bacteriile au și un fel de capac de 5 'format dintr-un trifosfat la capătul 5'. & # 9126 & # 93 Îndepărtarea a doi dintre fosfați lasă un monofosfat de 5 ', provocând distrugerea mesajului de exonuclează RNase J, care degradează 5' la 3 '.

Cifra de afaceri a ARNm eucariot

În interiorul celulelor eucariote, există un echilibru între procesele de translație și dezintegrarea ARNm.Mesajele care sunt traduse în mod activ sunt legate de ribozomi, factorii de inițiere eucariotă eIF-4E și eIF-4G și proteina de legare poli (A). eIF-4E și eIF-4G blochează enzima decapping (DCP2), iar proteina care leagă poli (A) blochează complexul exosom, protejând capetele mesajului. Echilibrul dintre translație și descompunere se reflectă în dimensiunea și abundența structurilor citoplasmatice cunoscute sub numele de corpuri P & # 9127 & # 93 Coada poli (A) a ARNm este scurtată de exonucleaze specializate care sunt direcționate către ARN-uri mesager specifice printr-o combinație a secvențelor cis-reglatoare pe ARN și proteinele care leagă ARN cu acțiune trans. Se consideră că îndepărtarea cozii poli (A) perturbă structura circulară a mesajului și destabilizează complexul de legare a capacului. Mesajul este apoi supus degradării fie de către complexul de exosomi, fie de complexul de decapitare. În acest fel, mesajele inactive translaționale pot fi distruse rapid, în timp ce mesajele active rămân intacte. Mecanismul prin care traducerea se oprește și mesajul este predat complexelor de descompunere nu este înțeles în detaliu.

Elementul bogat în UA se descompune

Prezența elementelor bogate în AU în unele ARNm de mamifere tinde să destabilizeze acele transcripții prin acțiunea proteinelor celulare care leagă aceste secvențe și stimulează îndepărtarea cozii poli (A). Se crede că pierderea cozii poli (A) promovează degradarea ARNm facilitând atacul atât al complexului exosom & # 9128 & # 93, cât și al complexului de decapare. & # 9129 & # 93 Degradarea rapidă a ARNm prin elemente bogate în AU este un mecanism critic pentru prevenirea supraproducției de citokine puternice, cum ar fi factorul de necroză tumorală (TNF) și factorul de stimulare a coloniei de granulocite-macrofage (GM-CSF). & # 9130 & # 93 Elementele bogate în UA reglează, de asemenea, biosinteza factorilor de transcripție proto-oncogenici, cum ar fi c-Jun și c-Fos. & # 9131 & # 93

Prostia mediată prin prostii

Mesajele eucariote sunt supuse supravegherii prin dezintegrare mediată fără sens (NMD), care verifică prezența codonilor de oprire prematură (codoni aiurea) în mesaj. Acestea pot apărea prin îmbinarea incompletă, recombinarea V (D) J în sistemul imunitar adaptativ, mutații în ADN, erori de transcripție, scanare cu scurgeri de către ribozom care provoacă o schimbare a cadrului și alte cauze. Detectarea unui codon oprit prematur declanșează degradarea ARNm prin decaparea 5 ', îndepărtarea cozii poli (A) 3' sau scindarea endonucleolitică. & # 9132 & # 93

ARN interferent mic (siARN)

În metazoane, ARN-urile mici interferente (ARNsi) procesate de Dicer sunt încorporate într-un complex cunoscut sub numele de complexul de reducere a zgomotului indus de ARN sau RISC. Acest complex conține o endonuclează care clivează mesaje perfect complementare la care se leagă ARNsi. Fragmentele de ARNm rezultate sunt apoi distruse de exonucleaze. ARNsi este utilizat în mod obișnuit în laboratoare pentru a bloca funcția genelor în cultura celulară. Se crede că face parte din sistemul imunitar înnăscut ca apărare împotriva virusurilor ARN dublu catenar. & # 9133 & # 93

MicroARN (miARN)

MicroARN-urile (miARN-urile) sunt ARN-uri mici, care sunt de obicei parțial complementare secvențelor din ARN-urile mesager metazoane. & # 9134 & # 93 Legarea unui miARN la un mesaj poate reprima traducerea acelui mesaj și accelera îndepărtarea cozii poli (A), accelerând astfel degradarea ARNm. Mecanismul de acțiune al miARN este subiectul cercetării active. & # 9135 & # 93

Alte mecanisme de descompunere

Există și alte modalități prin care mesajele pot fi degradate, inclusiv decăderea non-stop și reducerea la tăcere de către ARN-ul care interacționează cu Piwi (piRNA), printre altele.


Materiale și metode

Prepararea extractelor de creier de pui și fibroblaste

Extractul citoplasmatic al creierului a fost preparat din embrioni de pui de 12 d. Creierele întregi au fost îndepărtate și spălate de trei ori cu tampon A (20 mM Tris Cl, 3 mM MgCl2, 40 mM KCl și 1 mM DTT, 0,7 μg / ml leupeptină, 1 μg / ml aprotinină, 0,7 μg / ml pepstantină și 1 mM PMSF). S-a adăugat 1 ml de tampon A per gram de țesut umed și amestecul a fost omogenizat într-un omogenizator din sticlă de teflon. Omogenatele au fost centrifugate timp de 10 minute la 5.000 g, iar supernatantul a fost centrifugat timp de 2 ore la 28.000 rpm într-un rotor Beckman SW-40.1. Supernatantul de mare viteză a fost folosit imediat sau depozitat în alicote la –70 ° C. Concentrația de proteine ​​din extractul cerebral a fost de –10-20 μg / μl. Pentru a prepara extractul CEF, fibroblastele au fost izolate din țesutul muscular al sânilor embrionilor de pui de 11 d. Celulele au fost crescute până la confluență de -95% (Kislauskis și colab., 1994) și apoi răzuite și spălate în tampon rece A și peletizate prin centrifugare (Ross și colab., 1997). Celulele au fost resuspendate în tamponul A și omogenizate într-un omogenizator Dounce. Omogenatele au fost centrifugate așa cum s-a descris mai sus. Concentrația de proteine ​​a extractului preparat a fost de 5-10 μg / μl.

Culturi neuronale

Culturile primare ale neuronilor din creierul penei embrionare au fost generate așa cum s-a descris anterior (Zhang și colab., 1999). Pe scurt, forebrele au fost disecate din embrioni de pui 8-d, tripsinizate, disociate și placate pe polilizină- (0,2 mg / ml, 16 h) și laminină (0,02 mg / ml, 12 min) acoperitoare în MEM cu 10% FBS timp de 2 ore. Celulele au fost inversate pe un monostrat de astrocite de pui în N2-mediu condiționat cu ser (0,2% FBS) și cultivat timp de 4 zile la 37 ° C în 5% CO2.

Transcriere ARN in vitro

PCZIP a fost construit prin inserarea codului zip de 54 nucleotide al ARNm β-actină pui într-un vector pSP64-Poly (A) (Promega) la siturile Hind III și Ava I. Pentru a construi plasmida pCZIPm, următoarea pereche de oligo complementare au fost sintetizate, recocite și inserate între site-urile Hind III și Ava I ale vectorului pSP64 Poly (A): Sens: 5 ′ AGCTTACCGGACT-GTTACCATGTGTGTGTGTGCTGTGATGAAACAAAACCCATAGATGCGTGCGTGGTGG ′.

Pentru testele de deplasare a mobilității gelului, ARN marcat cu [32 P] a fost generat de ARN polimerază SP6 direcționată in vitro transcriere din ADN pCZIP liniarizat Ava I. ARN-ul transcris a fost purificat pe gel cu 6%. Pentru purificarea prin afinitate a ARN, transcrierea poliadenilată a fost sintetizată in vitro cu polimerază SP6 (kit MEGAScript Ambion) din construcții pCZIP Eco-liniarizate. S-au adăugat urme de [32 P] -CTP pentru a permite detectarea și cuantificarea ARN-ului transcris. ARN-ul transcris conținea 54 nts de ARN pCZIP și o coadă poli (A) de 30 nts.

Test de schimbare a mobilității gelului și reticulare UV

Pe scurt, 10 5 CPM din sonda ARN marcată cu [32 P] a fost incubată la temperatura camerei cu 5 μl de extract de proteină din creier sau fibroblast timp de 20 de minute într-o soluție de legare de 20 μl conținând 20 mM Hepes, pH 7,4, 50 mM KCl , 3 mM MgCI2, 2 mM DTT și 5% glicerol. ARN-urile nelegate au fost degradate printr-o incubație de 10 minute cu 1 U de RNază T1, și interacțiunile ARN-proteine ​​nespecifice au fost reduse la minimum prin incubare cu 5 mg / ml heparină timp de 10 min. Complexele ARN-proteine ​​formate au fost separate într-un gel nativ de 4% și vizualizate prin autoradiografie. Pentru a stabili specificitatea interacțiunilor ARN-proteină, s-au efectuat teste de concurență prin preincubarea extractului proteic cu concurenți ARN neetichetați.

Reticularea UV a complexelor ARN-proteine ​​a fost efectuată prin iradierea reacțiilor pe gheață într-o cameră UV (GS gene linker Bio-Rad Laboratories) cu 254-nm, 8-W becuri UV timp de 10 minute și rezolvate cu 4% gel nativ. Complexele ARN-proteină reticulate UV, detectate prin autoradiografie, au fost tăiate din gel, amestecate cu tampon de încărcare SDS și incubate cu 10 U RNază T1 timp de 30 de minute la temperatura camerei. Feliile de gel au fost încărcate pe un gel SDS-poliacrilamidă 10% și electroforizate pentru a distinge complexele ARN-proteină.

Purificarea prin afinitate a proteinelor care se leagă de ARN

2 ml de margele de poli (U) agaroză (tip 6 Amersham Pharmacia Biotech) au fost suspendate în tampon de legare a ARN-ului (25 mM Tris HCI, pH 7,4, 100 mM KCl) și ambalate într-o coloană de 10 ml. Aproximativ 1 mg ARN poli (A) cu cod poștal sintetizat in vitro a fost adăugat la coloană și ciclat de patru ori. Eficiența ARN-ului legat de perle de poli (U) agaroză a fost monitorizată prin măsurarea cantității de ARN marcat cu [32 P] prezent în preparatul de ARN. După legare, bilele au fost echilibrate cu tamponul de extract, amestecat cu 40 ml de extracte de proteine ​​din creier sau 20 ml de extracte de fibroblast conținând 50 U / ml RNasin (Promega) și incubate timp de 1 oră la temperatura camerei cu agitare ușoară. Pentru a reduce legarea nespecifică de proteine, s-au adăugat ARNt de drojdie și heparină la 50 μg / ml și, respectiv, 5 mg / ml la tamponul de legare. Margelele au fost apoi centrifugate timp de 2 minute la 1.000 g, resuspendat în tampon de legare și reambalat într-o coloană de 10 ml. Coloana a fost spălată extensiv în 5 × 20 ml de tampon de legare după cum urmează: (1) tampon de legare (2) tampon de legare + 40 μg / ml drojdie ARN (3) tampon de legare + 5 mg / ml heparină (4) tampon de legare + Numai tampon de legare Triton X-100 și (5) 0,1%. Proteinele reținute pe coloana de afinitate ARN au fost eluate cu un tampon Hepes 20 mM, pH 7,4, conținând 0,5, 1 și 2 M KCl. Proteinele eluate au fost analizate prin SDS-PAGE și testul de deplasare a benzii.

Producerea de anticorpi anti-ZBP2 de șobolan

Fracția de eluție 2-M KCl din coloana de afinitate a codului poștal a fost concentrată cu filtru centricon-30 și eletroforizată în 10% SDS-PAGE. După colorare cu albastru Coomassie, benzile proteice așteptate au fost tăiate din gel, zdrobite, amestecate cu adjuvant și injectate în șobolani (Covance, Inc.) pentru producerea de anticorpi. Titrul antiserului a fost testat prin imunoblot.

Imunoblotarea

Alicote de proteine ​​au fost rezolvate în 10% SDS-PAGE și transferate pe membranele Zeta printr-un blotter de transfer semisec (Laboratoarele Bio-Rad). Membranele au fost șterse peste noapte cu PBS conținând 5% lapte degresat la 4 ° C și apoi incubate cu antiser împotriva ZBP2 (1: 2.000) în PBS conținând 1% BSA timp de 2 ore la temperatura camerei. După ce s-a spălat de trei ori cu PBS / 0,3% Tween-20, membranele au fost incubate cu anticorpi anti-șobolan conjugați cu peroxidază de hrean (1: 8.000), ZBP2 a fost detectat cu sistemul ECL (Amersham Pharmacia Biotech) sau cu DAB / H2O2.

Imunoprecipitarea și detectarea ARNm de β-actină

10 μg de anticorpi purificați sau 5 μl de antiser împotriva ZBP2 au fost incubați cu 100 μl de extract de proteină cerebrală timp de 1 oră la 4 ° C cu agitare ușoară. La amestec s-au adăugat 30 pl de perle de agaroză cuplate cu proteină G (Pierce Chemical Co.) și incubate timp de încă 1 oră la 4 ° C. După centrifugare timp de 5 minute la 1.500 g, supernatantul a fost luat pentru imunoblotare și teste de deplasare a benzii de ARN. Pentru analiza ZBP2, mărgelele de agaroză peletate au fost spălate extensiv cu PBS și proteinele legate de margele au fost eluate cu 100 μl de tampon de eluare ImmunoPure IgG (Pierce Chemical Co.). Pentru detectarea ARNm de β-actină, granulele de agaroză peletate au fost spălate de trei ori cu DEPC-PBS, resuspendate în 100 pl de apă DEPC și fierte timp de 10 min. ARN total a fost extras din supernatant folosind reactiv de izolare TRIzol ARN (GIBCO BRL). RT-PCR pentru ARNm de β-actină a fost efectuat timp de 20 de cicluri cu 1 pl de ARN ca șablon folosind margele ReadyToGo RT-PCR (Amersham Pharmacia Biotech). Pentru amplificare s-au utilizat următorii primeri: 5 ′ CTGACACCTTCACCATTCCAG 3 ′ și 5 ′ ATTGCTGACAGGATGCAGAAG 3 ′. Produsul PCR așteptat este un fragment de ADN de 398-bp de ARNm de β-actină în 3 'UTR în pozițiile 1021-1419.

Izolarea și clonarea ADNc-ului ZBP2

Doi primeri, zbp2-1 și zbp2-2, au fost proiectați și sintetizați în conformitate cu cele două secvențe peptidice (aminoacizi ZBP2 621-627 și respectiv 685-709) și secvența ADNc KSRP umană (zbp2-1 GCTTGGGAGGAGTACTACAA, zbp2-2 AGGACCTGGGG ): Un fragment de ADN de 200 bp a fost amplificat dintr-o bibliotecă cerebrală de embrioni de pui (CLONTECH Laboratories, Inc.) și verificat prin secvențiere. Acest fragment a fost utilizat pentru screeningul bibliotecii creierului de embrioni de pui. Două clone de ADNc au fost izolate din screening-ul bibliotecii. După analiza secvenței, a fost evident că ambele clone conțineau o secvență de codare terminală COOH de 500 bp urmată de 150 bp de 3 'UTR. 5 ′ RACE PCR a fost aplicat pentru a obține un NH2-fragmentul terminal al ZBP2 (CLONTECH Laboratories, Inc.) Primerii RACE 4 au fost folosiți în experimentul 5 ′ RACE (RACE6-1: CACGCGGCGTTGGGGTCGGCTGC, RACE7: TTATAGGCGGCCCA-CGCGGCGTTGG, RACEF1: GAACGCGGTGCTGCT Secvențele fragmentelor de ADN amplificate de RACE au fost determinate prin analize automate ale secvenței de ADN. Gena de lungime completă a fost îmbinată împreună prin PCR și confirmată prin secvențiere.

Hibridizare in situ și imunocitochimie

Hibridizarea in situ a fost efectuată pe fibroblaste așa cum este descris de Kislauskis și colab. (1993) și asupra neuronilor descriși de Zhang și colab. (1999). CEF-urile vechi de 9 zile au fost cultivate în MEM suplimentat cu 10% FCS. După ce a crescut pe lamele de acoperire timp de 2 zile, celulele au fost fixate în paraformaldehidă 4% în PBS timp de 10 min și permeabilizate cu 0,5% Triton X-100 pentru încă 10 min la temperatura camerei. Distribuția ZBP2 în CEF a fost vizualizată prin incubarea antiserului de șobolan împotriva ZBP2 (1: 800) urmată de anticorpi anti-șobolan conjugați Cy3 sau FITC (1: 500 Jackson ImmunoResearch Lab). Neuronii au fost cultivați în mediu condiționat N2 cu 2% ser fetal bovin (FBS) timp de 2 sau 4 zile și fixați în 4% paraformaldehidă în PBS timp de 15 minute la temperatura camerei. După permeabilizare cu 0,5% Triton X-100, celulele au fost incubate cu antiser de șobolan împotriva ZBP2 (1: 750) urmat de anticorpi anti-șobolan marca i3 Cy3 (1: 750). Pentru hibridizare in situ și imunochimie, celulele au fost mai întâi procesate pentru hibridizarea ARN-β-actinei, spălate cu PBS și imunocolorate așa cum s-a descris anterior (Zhang și colab., 1999). Celulele au fost vizualizate cu un Olympus B × 60 cu obiectiv 60 × Plan Apo 1.4NA. Imaginile au fost achiziționate cu o cameră CCD răcită, operată de software-ul de imagistică Espirit.

Construcții de proteine ​​de fuziune GFP

ADNc uman KSRP (omologul puiului ZBP2), un cadou de la D. Black (Universitatea California din Los Angeles, Los Angeles, CA), a fost subclonat în vectorul pEGFP C1 (CLONTECH Laboratories, Inc.) la EcoRI și Hind III site-uri. (pGFP-KSRP). Toate celelalte construcții de fuziune EGFP sunt fie pui de lungime completă, fie pui trunchiat ZBP2. Fragmentul de domeniu central conținând secvența aa 103-650, inclusiv secvența 47-aa unică pentru domeniile ZBP2 și 4-KH, a fost amplificat prin PCR și donat în vectorul pEGFP-C1 la site-urile EcoRI și Xbal pentru a genera plasmida pGFP-CD. Domeniile 4-KH ale ZBP2 au fost donate în vectorul pEGFP-C1 la site-ul SalI și XbaI pentru a produce pGFP-KH construct. Secvența unică de 47-aa a fost amplificată prin PCR și introdusă în pEGFPC1 la EcoRI Hind III (site-ul pGFP-IN). Domeniul terminal COOH, inclusiv de la aminoacizii 650 până la codonul stop, au fost excizați din plasmida pBS-LS2 (izolată din screeningul bibliotecii) utilizând site-uri EcoRI și XhoI și clonate în vectorul pEGFPC1, generând pGFP-CT. ZBP2 de lungime completă a fost donat în pEGFPC2 (CLONTECH Laboratories, Inc.) la site-urile EcoRI și Hind III pentru a genera pGFP-FULL. Secvența unică de 47-aa a fost ștearsă din ZBP2 de lungime completă prin PCR în două etape și a fost clonată în vectorul pEGFPC2 de către site-urile EcoRI și Hind III pentru a genera pGFP-Δ47. Toate constructele menționate mai sus au fost verificate prin secvențierea ADN-ului.

Transfecția și imagistica celulelor transfectate

CEF-urile au fost transfectate timp de 4-5 ore cu construcții GFP-ZBP2 utilizând reactivul Qiagen Effectene conform protocolului producătorului. Neuronii cultivați au fost transfectați cu DOTAP așa cum este descris (Zhang și colab., 1999). A fost efectuată imagistica GFP cu sau fără FISH (Zhang și colab., 1999). Pentru CEF, semnalele de ARNm GFP și β-actină au fost vizualizate prin microscopie cu fluorescență utilizând un microscop Olympus B × 60 cu obiectiv de 60 ×, n.a. 1.4. Cel puțin 50 de celule transfectate au fost numărate pe acoperire pentru localizarea ARNm β-actină.

Fuziunea EGFP / ZBP2 exprimată în neuroni a fost identificată folosind o microscopie cu fluorescență (microscop inversat Nikon Eclipse) echipat cu obiectiv Plan-Neofluar 60 ×, optică de fază, lampă cu arc de mercur de 100 W și filtre de bandă HiQ (ChromaTech). Imaginile cu fluorescență au fost imediat obținute într-un timp de expunere constant (1 s) cu o cameră CCD răcită care a fost rulată de software-ul de computer IP Lab. Perimetrul fiecărei dendrite axonale (primii 30 μm din corpul celulei) a fost urmărit folosind imaginea de fază. Regiunea de interes a fost transferată în imaginea de fluorescență din aceeași celulă, iar intensitatea fluorescenței ARN-β-actinei a fost măsurată prin software-ul IP Lab. Intensitatea fluorescenței ROI în celulele netransfecționate de pe lamelă a fost măsurată ca un control normal. Au fost analizate peste 20 de celule din fiecare grup.


ARN Messenger (ARNm)

ARN-ul Messenger (sau ARNm) are rolul principal în transcriere sau primul pas în fabricarea unei proteine ​​dintr-un plan ADN. ARNm este format din nucleotide găsite în nucleu care se reunesc pentru a face o secvență complementară ADN-ului găsit acolo. Enzima care pune împreună această catenă de ARNm se numește ARN polimerază. Trei baze de azot adiacente din secvența ARNm se numesc codoni și fiecare codifică un aminoacid specific care va fi apoi legat cu alți aminoacizi în ordinea corectă pentru a produce o proteină.

Înainte ca ARNm să treacă la următoarea etapă a expresiei genelor, trebuie mai întâi să fie supusă unor prelucrări. Există multe regiuni ale ADN-ului care nu codifică nicio informație genetică. Aceste regiuni necodificate sunt încă transcrise de ARNm. Aceasta înseamnă că ARNm trebuie mai întâi să taie aceste secvențe, numite introni, înainte de a putea fi codificat într-o proteină funcțională. Părțile ARNm care codifică aminoacizii se numesc exoni. Intronii sunt tăiați de enzime și rămân doar exonii. Acest fir unic de informații genetice este acum capabil să se deplaseze în afara nucleului și în citoplasmă pentru a începe a doua parte a expresiei genetice numită traducere.


Expresia genelor


Informațiile de codificare din genomi sunt transcrise în trepte corespunzătoare uneia sau câteva gene. Secvențele ADN care codifică genele și reglează (cis-acționează) care direcționează inițierea transcripției, alungirea și terminarea sunt denumite în mod colectiv o unitate de transcripție. Unitățile de transcriere procariotice, numite operoni, conțin mai multe gene, adesea codificând proteine ​​înrudite fiziologic (Fig. 15-2A). Operonii sunt flancați de secvențe care direcționează inițierea și încetarea transcripției.Figura 15-2B prezintă o unitate de transcripție eucariotă simplă care codifică lanțul β al hemoglobinei umane. Deși doar o mică parte din această regiune codifică polipeptida β-globină, secvențele de reglare adiacente sunt cruciale pentru exprimarea corectă a β-globinei. Defectele genetice care duc la scăderea producției de β-globină se numesc β-talasemii. Astfel de mutații pot apărea fie în regiunea codificatoare, rezultând o polipeptidă instabilă sau trunchiată, fie în regiunile martor adiacente, ducând la niveluri scăzute de transcripție sau procesare aberantă a ARN-ului nou sintetizat (vezi Capitolul 16). Astfel, unitatea de transcripție poate fi gândită ca o serie legată de module, toate acestea trebuie să fie funcționale pentru ca gena să fie transcrisă la nivelul corect.


ARN ribozomal eucariot este sintetizat dintr-un set de gene repetate în tandem ca o singură moleculă, care este scindată și modificată pentru a da ARN-urile finale 28S, 5.8S și 18S (Fig. 15-3). Acestea sunt asamblate, împreună cu ARN 5S și aproximativ 80 de proteine, în ribozomi din nucleol. ARN-ul de transfer este sintetizat în nucleu și transportat la citoplasmă, unde este încărcat cu aminoacizi înainte de a participa la sinteza proteinelor (vezi Capitolul 17). snARN-urile sunt sintetizate și procesate în nucleu. De acolo, ei migrează către citoplasmă, unde dobândesc proteine ​​esențiale, apoi se întorc la nucleu, unde funcționează în reacțiile enzimatice ale procesării ARN-ului (splicing vezi Capitolul 16). Calea de procesare postsintetică pe care o urmează o anumită transcriere este dictată, parțial, de mașina de transcriere care este utilizată pentru inițierea și alungirea transcrierii și de anumite caracteristici ale ARN-ului naștent.


(B, prin amabilitatea lui Yvonne Osheim, Universitatea din Virginia, Charlottesville.)


(B, fișier PDB: 1I50. Referință: Cramer P, Bushnell DA, Kornberg RD: Baza structurală a transcripției: ARN polimerază II la rezoluția 2,8 angstrom. Știință 292: 1863–1876, 2001. D, de la Zhang G, Campbell EA, Minakhin L, și colab.: Structura cristalină a ARN polimerazei miezului Thermus aquaticus la rezoluția 3,3 Å. Celula 98: 811-824, 1999.)


Încărcarea ARN polimerazei pe ADN-ul genomic dublu catenar la o secvență promotor este cel mai bine înțeleasă în procariote și este discutată mai întâi înainte de discuția eucariotelor. Inițierea are loc într-o serie de pași definiți (Fig. 15-1). În primul rând, holoenzima se leagă de promotorul dublu catenar, formând ceea ce se numește complexul închis. Specificitatea și forța acestei interacțiuni sunt dictate de contactele specifice secvenței dintre factorul σ și bazele din elementele -10 și -35 ale promotorului (Fig. 15-6). Al doilea pas în inițiere este formarea unui complex deschis în care o regiune de 14 bp în jurul sitului de pornire a transcripției este nepereche, producând o bulă de transcripție. Această despărțire este însoțită de o schimbare conformațională a polimerazei care poziționează șablonul ADN cu o singură catenă în situsul activ și îngustează fanta de legare a ADN-ului, închizând efectiv clema polimerazei. În pasul următor, șablonul ADN din perechea de bază a sitului activ cu primele două ribonucleotide, iar prima legătură fosfodiester este catalizată. Acest proces se repetă până când ARN născut atinge o lungime de opt până la nouă baze, moment în care adăugarea de baze la lanțul de ARN în creștere are ca rezultat despărțirea unei baze a hibridului ARN-ADN, iar ARN născut începe să iasă prin un canal pe suprafața polimerazei. Schimbarea conformațională rezultată în polimerază duce la eliberarea factorului σ și la formarea unui complex ternar stabil (cu trei căi) care conține ARN polimerază, șablonul ADN și ARN nașterea.


ARN polimeraza II GTF conține mai mult de 20 de polipeptide cu o greutate moleculară agregată mai mare de 106 D (Tabelul 15-1). Înainte ca ARN polimeraza II să poată iniția transcrierea in vitro, trebuie să apară o asamblare ordonată a factorilor la promotor. Asamblarea complexului de preinițiere a ARN polimerazei II începe cu legarea TFIID, un factor mare (~ 700 kD) format din proteine ​​TATA care leagă cutia (TBP) și un set de factori asociați TBP numiți TAFII (Fig. 15-7A) . TBP singur este suficient pentru transcrierea bazală, în timp ce TAF aparent servesc drept ținte pentru activarea ulterioară a transcripției (vezi secțiunile următoare). TBP este prima polipeptidă din mașina de transcripție bazală care recunoaște o secvență specifică de ADN în timpul procesului de inițiere. Legarea ADN-ului este asigurată de un domeniu 180-aminoacid C-terminal extrem de conservat, care formează un monomer în formă de șa cu o axă de simetrie diadică (Fig. 15-7B). Partea inferioară a „șeii” TBP se leagă de canelura minoră a secvenței TATA, care este deschisă în proces. O îndoire pronunțată a ADN-ului este produsă la fiecare capăt al elementului TATAAA prin intercalația lanțurilor laterale de fenilalanină (Fig. 15-7C).


(B-D, fișier PDB: 1VOL. Coordonatele TBP + DNA sunt oferite de Stephen Burley, Universitatea Rockefeller, New York.)


Rezultate

Identificarea proteinelor care leagă codul poștal

Pentru a identifica proteinele care s-au legat de codul poștal al ARNm-ului & # x003b2-actină, s-au folosit abordări de deplasare a mobilității ARN și de reticulare UV (Ross și colab., 1997). Transcrierile codului poștal radiomarcat au fost utilizate pentru testele de schimbare a mobilității ARN. Trei complexe distincte de proteine ​​ARN și # x02013 s-au format atunci când sonda codului poștal marcat a fost incubată cu extracte din creier sau fibroblaste (Fig. 1 A, complexele benzilor 1 și # x020134 sunt indicate prin săgeți). Intensitatea complexelor deplasate a fost proporțională cu cantitatea de extract de creier utilizată (benzile 1 și # x020133). Complexul cu migrare rapidă (F) a fost observat atât în ​​extracte de creier, cât și în extracte de fibroblaste (benzile 3 și respectiv 4). Cu toate acestea, cele două complexe de migrare mai lentă (M și S) au fost mai evidente în creier decât în ​​extracte de fibroblaste (benzile 3 și 4). Specificitatea complexelor a fost determinată de teste de concurență în care excesul de 100 de ori de cod poștal neetichetat a concurat cu formarea complexelor (banda 5), ​​în timp ce excesul de 100 de ori de ARN neetichetat transcris din vectorul pGEM 3Z nu a interferat cu complexul formare (date nepublicate).

Caracterizarea proteinelor care se leagă de codul poștal din extractele de creier și de fibroblaste ale embrionului de pui. (A). Complexe formate din creier și fibroblaste. Transcrierile marcate cu [32 P] care codifică codul poștal de 54 nts ale 3 & # x02032 UTR ale ARN-ului de pui și # x003b2-actină au fost incubate cu alicote de extracte de proteine ​​din creierul embrionului de pui și fibroblaste, urmate de incubare cu RNase T1 (50 U / ml ) și heparină (5 mg / ml). Complexele de proteine ​​ARN și # x02013 au fost rezolvate în geluri native de poliacrilamidă 4% care au fost apoi uscate și expuse la filmul cu raze X Kodak. (Liniile 1, 2 și 3) Transcript marcat cu [32 P] incubat cu 1-, 2 și respectiv 5 - & # x003bcl extracte de creier, respectiv. (Banda 4) Transcript marcat cu [32 P] incubat cu extract de fibroblast 5 & # x003bcl. (Lane 5) Transcript marcat cu [32 P] incubat cu 5 - & # x003bcl extract de creier în prezența a 100 & # x000d7 cantități molare în exces de 3 & # x02032 UTR neetichetate ale transcrierilor ARNm de actină. Săgețile indică complexele proteice ale ARN-ului lent (S), mediu (M) și cu migrare rapidă (F) & # x02013. (B) Specificitatea complexelor pentru codul poștal. (Linia 1) Cod poștal incubat cu extract de creier. (Banda 2) Cod poștal mutant incubat cu extract de creier. (C) Test de reticulare UV. Transcrierile marcate cu [32 P] au fost incubate cu extract de creier, tratate cu RNase T1 și expuse la lumina UV timp de 3 minute la o distanță de 1 cm. Fiecare dintre complexele de proteine ​​ARN & # x02013 (F, M și S) a fost identificat și excizat dintr-un gel nativ de poliacrilamidă 4%, înmuiat în tampon SDS și rezolvat în 10% SDS-PAGE. (Stânga trei benzi) ARN excizat & # x02013proteinele complexe F, M și S care nu erau reticulate UV. (Dreapta trei benzi) ARN excizat & # x02013 complexe proteice F, M și S care au fost reticulate. Săgețile indică mobilitatea proteinelor cu ARN marcat legat.

Deoarece un cod poștal mutant nu a reușit să localizeze ARNm reporter (Ross și colab., 1997), am motivat că codul poștal mutant nu ar forma un complex proteic ARN și # x02013. Pentru a testa acest lucru, am generat un cod poștal mutant radiolabil în care cele două motive ACACCC au fost înlocuite cu GTGTGT și am efectuat teste de deplasare a mobilității ARN cu extracte de creier (Fig. 1 B). Spre deosebire de codul poștal de tip sălbatic (banda 1), codul poștal mutant nu a reușit să formeze complexe de proteine ​​ARN și # x02013 (Fig. 1 B, banda 2). Acest lucru a indicat faptul că proteinele din extractul creierului nu s-au legat de codul zip mutant și a demonstrat că o mutație care afectează localizarea ARNm poate fi corelată cu legarea afectată a proteinei de legare a ARN și # x02013. Pentru a distinge componentele proteice care se leagă de codul poștal, am folosit UV pentru a lega complexele de proteine ​​ARN și # x02013 formate prin amestecarea codului poștal radiomarcat cu extracte din creier și am analizat complexele prin SDS-PAGE. Toate cele trei complexe de proteine ​​ARN și # x02013 nu au fost detectabile fără reticulare (Fig. 1 C, fără UV-X). Când complexele de proteine ​​ARN & # x02013 au fost reticulate și stabilizate, au fost vizualizate benzile specifice (UV-X). Complexul F conținea o proteină reticulată cu o masă moleculară estimată de & # x0223c68 kD, aceeași masă moleculară ca ZBP1 (Ross și colab., 1997). Complexele M și S (benzile îmbogățite în creier) conțineau o proteină reticulată cu o masă moleculară estimată de & # x0223c92 kD. Diferența de migrație a complexelor M și S în gelul nativ și identitatea în masa moleculară pe SDS-PAGE, au sugerat că complexul S ar putea fi un dimer al complexului M. Din aceste date concluzionăm că proteinele de 68 și 92 kD se leagă la codul poștal, semnalul de localizare ARNm & # x003b2-actină. Banda de 68 kD este probabil ZBP1, dar cealaltă ZBP este exprimată preferențial în creier. Proteina 92-kD a fost numită ZBP2. Faptul că acestea se separă în complexe separate indică faptul că ZBP1 și ZBP2 nu se leagă simultan de codul poștal.

Purificarea ZBP-urilor

Pentru a identifica proteina îmbogățită cu creierul, am purificat ZBP folosind tehnici de selectare a afinității ARN. Am trecut extracte de creier sau fibroblaste cultivate peste o coloană de cromatografie de afinitate conținând ARN cu cod poștal. După spălări extinse, proteinele reținute pe coloană au fost eluate cu creșterea etapelor de concentrație de sare și analizate prin SDS-PAGE cu colorare cu argint (Fig. 2 A). Deși extractul inițial și fracția de curgere au fost eterogene (Fig. 2 A, banda 1), după o serie de spălări (benzile 2 & # x020135), proteinele specifice au fost eluate cu condiții crescătoare de sare (Fig. 2 A, benzile 7 & # x020139). Fracția de proteină eluată cu KCl 1 și 2 M conținea benzi proteice distincte (Fig. 2 A, benzi 8 și 9, săgeți) trei proteine ​​erau & # x0223c68 kD și una era 92 kD. Masele moleculare estimate au fost în strâns acord cu cele ale complexelor proteice de ARN reticulat UV și # x02013 identificate prin SDS-PAGE (Fig. 1 B). O proteină cu masă moleculară mai mică (53 kD) a fost, de asemenea, detectată anterior (Ross și colab., 1997).

Analiza proteinelor fracționate prin cromatografie de afinitate ARN. (A) Analiza SDS-PAGE. Alicote (30 & # x003bcl) de proteine ​​în fiecare etapă de purificare eluată din cromatografia de afinitate cu ARN au fost rezolvate în 10% SDS-PAGE. (Banda 1) Fracție de curgere. (Lanes 2 & # x020136) Proteine ​​în cinci etape succesive de spălare, respectiv. (Lanes 7 & # x020139) Proteine ​​în fracții de eluție 0,5, 1,0 și respectiv 2,0 KCl. Masa moleculară a proteinelor este marcată în poziția corectă. Săgețile mici denotă cele cinci proteine ​​care au fost micro-secvențiate. (B) Test de schimbare a gelului utilizând proteinele selectate de afinitate. Alicote (5 & # x003bcl) din fiecare ca în A (fracție) au fost incubate cu 1 & # x000d7 10 5 CPM de transcriere cod poștal etichetat [32 P] și complexele formate au fost rezolvate în 4% geluri native. (C) Material de pornire. Săgețile reprezintă complexele de proteine ​​ARN și # x02013 identificate în Fig. 1 A.

Pentru a determina dacă proteinele eluate din coloana de afinitate ARN conțineau activitate de legare a ARN, am efectuat testul de deplasare a mobilității benzii prin incubarea codului poștal radiomarcat cu proteine ​​din fiecare dintre etapele de purificare (Fig. 2 B). În comparație cu materialul de pornire (Fig. 2 B, banda C), s-a detectat o activitate îmbunătățită de legare a ARN în fracțiunile KCl 1- și 2-M (benzile 7 și 8). Activitatea de legare a ARN-ului nu a fost găsită în flux (Fig. 2 B, banda 2), pași de spălare (Fig. 2 B, benzi 3 & # x020136) și fracția KCl 0,5-M (Fig. 2 B, banda 6 ), indicând faptul că proteinele care leagă ARN au fost îmbogățite în fracțiunile KCl 1- și 2-M după purificarea afinității ARN. Surprinzător, deși fracțiunile KCl 1- și 2-M conțineau proteine ​​92- și 68-kD, după incubare cu cod poștal radiomarcat, s-au format numai complexe M și S (Fig. 2 B, benzile 8 și 9). Absența relativă a complexului F în testul de deplasare a benzii a sugerat fie că proteina 68-kD și-a pierdut activitatea de legare a ARN-ului în condiția de eluție ridicată a sării, fie că legarea proteinei 68-kD la codul poștal necesită proteine ​​suplimentare care nu sunt prezente sau activ în fracțiunea mare de sare.

Microsecvențierea proteinelor purificate prin afinitate

Proteinele din fracția 2-M KCl a coloanei de afinitate ARN (Fig. 2 A, banda 9) au fost concentrate cu un filtru centricon-30, rezolvate în 12% SDS-PAGE și vizualizate prin colorare cu albastru Coomassie. Patru benzi proteice de & # x0223c92, 70, 65 și 45 kD au fost eluate din gel și micro-secvențiate. Șase peptide ale proteinei purificate de 92 kD, pe care le-am denumit ZBP2, au fost obținute după microsecvențiere. O căutare în baza de date cu secvențele peptidice ale ZBP2 a arătat că cele șase peptide se potriveau cu o proteină nucleară umană, KSRP, care a fost identificată anterior ca un factor de îmbinare regulator (Min și colab., 1997). Celelalte trei proteine ​​au fost, de asemenea, identificate prin secvențele lor peptidice. Proteina 70-kD a fost un omolog al unei proteine ​​umane, FBP, care a fost cunoscut ca factor de transcripție pentru c-myc genă (Duncan și colab., 1994). Proteina 65-kD a fost o proteină necunoscută. Nu am secvențiat proteina de 68 kD, deoarece am presupus că această proteină era ZBP1 (Ross și colab., 1997). Proteina de 45 kD a fost identificată ca ssDBF, un factor de legare ADN cu un singur fir la pui (Smidt și colab., 1995) și a fost omologă cu o proteină umană, ABBP, o proteină hnRNP de tip A / B care joacă un rol în Editarea ARNm (Lau și colab., 1997).

Izolarea ADNc-ului de pui pentru ZBP2

ZBP2 care codifică ADNc a fost obținut prin screeningul a trei biblioteci de ADNc de pui și amplificarea rapidă a capetelor de ADNc (RACE) -PCR amplificarea terminalului 5 & # x02032. ZBP2 și KSRP uman împart & identitatea # x0223c81% în secvența de acid nucleic și identitatea & # x0003e86% în secvența de aminoacizi (aa) (Fig. 3), indicând faptul că ZBP2 / KSRP este o proteină foarte conservată. La fel ca în cazul KSRP și ZBP1 uman, ZBP2 conține, de asemenea, patru domenii de legare a ARN-ului omologiei hnRNP tip K (KH) și o regiune terminală COOH îmbogățită în glutamine, cu patru repetări ale unui motiv AWEEYYK și un NH2-domeniul bogat în prolină-glicină terminală (Fig. 3). Cu toate acestea, puiul ZBP2 conține un segment de 47-aa înainte de primul domeniu KH care nu a fost găsit în KSRP și diferențe semnificative de secvență la capătul 5 & # x02032 al ARNm.

Secvența completă de ZBP2 în comparație cu KSRP uman. Proteinele din fracția de eluție de 2,0 KCl din coloana de afinitate ARN așa cum se arată în Fig. 2 au fost concentrate cu un filtru contricon-30 (Amicon) și electroforizate în SDS-PAGE 10%. Proteinele vizualizate prin colorarea cu albastru Coomassie au fost excizate pentru micro-secvențiere. Secvențele subliniate arată cele cinci peptide micro-secvențiate de 16, 13, 13, 7 și 24 aa de ZBP2 purificat (92 kD). Regiunile roșii indică cele patru domenii de omologie K foarte conservate ale hnRNP. Rețineți prolina, NH bogat în glicină2-domeniul terminal și COOH-terminal bogat în glutamină al ZBP2. Identitatea ZBP2 și KSRP este de 86%. ZBP2 este disponibil la GenBank / EMBL / DDBJ / nr de acces. <"type": "entrez-nucleotide", "attrs": <"text": "AF461020", "term_id": "18252631" >> AF461020.

ZBP2 este asociat cu codul poștal din creierul de pui și fibroblaste

Pentru a facilita studiile noastre cu privire la rolul ZBP2 pentru localizarea ARNm, am generat anticorpi prin injectarea ZBP2 purificat cu gel la șobolani. Specificitatea anticorpilor ZBP2 a fost determinată prin analiza Western blotting (Fig. 4 A), în care anticorpii de șobolan împotriva ZBP2 au recunoscut în mod specific ZBP2 atât în ​​extracte de fibroblast și creier, cât și în fracțiuni proteice purificate prin afinitate (Fig. 4 A, benzile 1 și # x020133).

Caracterizarea anticorpilor la ZBP2. Anticorpii împotriva ZBP2 au fost obținuți prin injectarea în șobolani a ZBP2 purificat cu gel SDS-PAGE. (A) Western blot la ZBP2. (Banda 1) Extract de creier brut. (Banda 2) Extract brut de fibroblaste. (Banda 3) Fracție proteică purificată de afinitate 1,0 M KCl din extractul creierului. Săgeata indică ZBP2. (B) Antiserul împotriva ZBP2 sau a serului preimun a fost incubat cu extract de creier timp de 2 ore urmat de incubare cu mărgele de proteină G de agaroză timp de 2 ore la 4 & # x000b0C. Supernatanții, după centrifugare la 1.500 rpm timp de 10 min, au fost analizați prin testul de deplasare a motilității pentru capacitatea lor de a forma un complex de proteine ​​ARN & # x02013. (Banda 1) Controlul extractului cerebral. (Banda 2) Extract de creier incubat cu ser preimun de șobolan. (Banda 3) Extract de creier incubat cu ser anti-ZBP2. Săgețile denotă complexele de proteine ​​ARN și # x02013 identificate în Fig. 1 A. (C) Aceleași probe ca în B au fost utilizate pentru Western blot. (Banda 1) Controlul extractului cerebral. (Banda 2) Extract de creier incubat cu ser preimun de șobolan. (Lane 3) extract de creier imunodepletat folosind ser anti-ZBP2. Săgeata indică ZBP2.

Pentru a ne asigura că ZBP2 din extractele cerebrale a fost proteina care a format complexele M și S cu codul poștal, am imunodepletat ZBP2 din extracte din creier și am efectuat teste de deplasare a mobilității ARN pentru a detecta complexele de proteine ​​ARN și # x02013 (Fig. 4 B). Când supernatanții dintr-o imunoprecipitare cu anticorpi ZBP2 au fost incubați cu codul poștal, complexele proteice specifice ARN și # x02013 M și S au fost mult reduse (Fig. 4 B, banda 3). Imunoprecipitarea cu anticorpi anti-ZBP2 părea a fi specifică, deoarece complexul F a fost ușor redus (Fig. 4 B, banda 3). În schimb, când testul de deplasare a mobilității ARN a fost efectuat cu supernatanții după imunoprecipitare de către un ser preimun de șobolan de control, nu s-a găsit nicio reducere a intensității complexelor proteice ARN și # x02013 așteptate (Fig. 4 B, banda 2). Acest lucru a confirmat că formarea complexelor M și S a fost dependentă de prezența ZBP2. Formarea complexului F a fost probabil dependentă de ZBP1, care nu este recunoscut de anticorpii ZBP2. Pentru a verifica dacă ZBP2 a fost imunodepletat din extracte cu anticorpi anti-ZBP2, aceleași supernatante utilizate în testul de deplasare a mobilității de mai sus au fost analizate prin Western blot (Fig. 4 C). Rezultatul a arătat că, spre deosebire de serul preimun de control și de șobolan și supernatanții tratați (Fig. 4 C, benzile 1 și 2), ZBP2 a fost eliminat de anticorpii anti-ZBP2 (Fig. 4 C, banda 3).

Reglarea dezvoltării ZBP2

Pentru a determina modelul de expresie a ZBP2 în neuroni în curs de dezvoltare, s-au preparat extracte de proteine ​​din diferite etape de dezvoltare ale creierului de pui și au fost analizate pentru nivelurile de ZBP2 prin Western blot (Fig. 5). Cea mai mare expresie a ZBP2 a fost observată la embrionii 6-d (Fig. 5, & # x200B, 6 6 d), nivelul de expresie a fost redus la 30% înainte de eclozare și a rămas stabil după aceea (Fig. 5). În schimb, cantitatea de proteină & # x003b2-actină este aproape constantă în aceleași momente de timp. Acest lucru este în concordanță cu evenimentele din timpul embriogenezei neuronale, când axonii și dendritele sunt la creștere maximă și coincide, de asemenea, cu expresia ZBP1 (date nepublicate).

Expresia embrionară a ZBP2. Proteinele au fost extrase din creierele embrionilor de pui în diferite etape și au rulat pe SDS-PAGE 10% înainte de Western blot folosind anticorpi ZBP2 și & # x003b2-actină.Raporturile relative ale ZBP2 pe intensitate de actină au fost calculate pentru etapele indicate (în zile).

Distribuția de & # x003b2-actin mARN și ZBP2 în CEF și neuroni. CEF-urile (A) și neuronii (B) au fost cultivate și fixate așa cum este descris în Materiale și metode. Celulele au fost hibridizate in situ cu ARNm de & # x003b2-actină (Cy3, roșu) și prin imunofluorescență la ZBP2 (FITC, verde). Suprapunerea este indicată în dreapta lui A și în B. Imaginea în B este o secțiune optică simplă, deconvoluită, suprapusă. Vârfurile de săgeată arată colocalizarea mRNA ZBP2 și & # x003b2-actină în procesele neuronale și în conul de creștere. Bare, 10 & # x003bcm.

Localizarea celulară a ZBP2

Pentru a investiga localizarea subcelulară a ZBP2 și dacă ZBP2 a fost asociat cu ARNm de & # x003b2-actină in vivo în fibroblaste și neuroni, am efectuat o analiză combinată, utilizând hibridizare in situ cu sonde oligo nucleotidice marcate fluorescent pentru ARN de & # x003b2-actină (roșu Fig. 6, A, panoul din stânga și B), și cu anticorpi pentru ZBP2 (verde Fig. 6, A, panoul din mijloc și B). ZBP2 este prezent predominant în nucleele celulare. Cu toate acestea, ocazional, o cantitate semnificativă de ZBP2 a fost detectată prin imunofluorescență în marginea anterioară a CEF și conul de creștere al neuronilor care dezvoltă pui. Le-am suprapus imaginile (Fig. 6, A, dreapta și B) unde mRNA ZBP2 și & # x003b2-actină s-au suprapus (galben) în marginea anterioară a CEF (Fig. 6 A, dreapta) și conul de creștere al neuronilor (Fig. 6 B, săgeți). Acest lucru a furnizat dovezi că ARNm de ZBP2 și & # x003b2-actină au fost asociate spațial in vivo în celulele examinate. Deși proteina și ARN-ul sunt distribuite în general în aceeași regiune a neviților, ocazional se suprapun. Atât ARNm & # x003b2-actină, cât și ZBP2 prezintă o distribuție punctată, deosebit de evidentă în neuroni, în concordanță cu observațiile particulelor localizatoare (Ainger și colab., 1993 Zhang și colab., 2001).

ARNm ZBP2 și & # x003b2-actină sunt asociate fizic

Pentru a determina dacă ARNm-ul ZBP2 și & # x003b2-actină ar putea fi asociat fizic, am folosit imunoprecipitare urmată de teste RT-PCR pentru a determina dacă peleta imunoprecipitată cu anticorpi anti-ZBP2 conținea ARNm de & # x003b2-actină (Fig. 7). ARN a fost izolat din peleta imunoprecipitată din extractul creierului folosind fie anticorpi anti-ZBP2, fie ser preimun de șobolan, și apoi supus RT-PCR. Pentru amplificarea PCR a fost ales un fragment de 398-bp al mRNA 3 & # x003b2-actină & # x02032 regiune netradusă (UTR). Am folosit o plasmidă fără ADNc de & # x003b2-actină ca martor negativ (Fig. 7, banda 1) și o plasmidă cu ADNc de & # x003b2-actină ca control pozitiv (Fig. 7, banda 6). Un fragment din 3 & # x02032 UTR al ARNm-ului & # x003b2-actinei a fost amplificat din imunoprecipitările cu antiser ZBP2 sau anticorpi (Fig. 7, benzile 3 și 5). Imunoprecipitările cu ser de șobolan preimun sau IgG nu au demonstrat niciun fragment de ADN amplificat cu PCR (Fig. 7, benzile 2 și 4). Acest experiment a indicat faptul că mRNA-actina & # x003b2-actina și ZBP2 au fost cel mai probabil asociate fizic între ele în extracte de creier de pui.

& # x003b2-ARNm de actină a fost coprecipitat cu ZBP2. Anticorpii ZBP2 au fost utilizați pentru a imunoprecipita un extract CEF. Amorsele pentru ARNm de & # x003b2-actină au fost utilizate într-un test RT-PCK pentru a detecta prezența de ARNm de & # x003b2-actină în pelete. (Banda 1) Controlul PCR negativ nu are grunduri. (Banda 2) Ser preimun de șobolan. (Banda 3) ZBP2 antiser. (Banda 4) IgG normal purificat de șobolan. (Banda 5) IgG ZBP2 purificat prin afinitate. (Banda 6) Control PCR pozitiv folosind ADNc de lungime completă a mRNA & # x003b2-actină ca șablon. M este markerul molecular ADN. Săgeata denotă fragmentul de ADN amplificat de PCR al 3 & # x02032 UTR al mARN-ului & # x003b2-actină.

Porțiuni de ZBP2 pot determina distribuția nucleară și citoplasmatică

Pentru a determina dacă naveta ZBP2 între nucleu și citoplasmă, am fuzionat-o cu proteina de fluorescență verde îmbunătățită (EGFP) și am analizat compartimentarea proteinei fluorescente atât în ​​fibroblaste, cât și în neuroni. Diferitele porțiuni de ZBP2 care au fost fuzionate cu GFP au inclus segmentul 47-aa (roșu), cele patru domenii centrale KH (albastru) și repetările terminale COOH (gri) (Fig. 8 A). Diferite domenii ale ZBP2 controlează compartimentarea nucleară sau citoplasmatică a EGFP fuzionată la aceasta (numerele indică procentul de celule cu fluorescență citoplasmatică în fibroblaste). Domeniul terminal COOH (Fig. 8 B) și patru domenii KH (Fig. 8 D) au fost distribuite în întreaga celulă, în timp ce când cele 47 aa au fost adăugate la domeniul 4-KH, pe care îl numim domeniul central, localizarea a fost aproape în întregime nucleară (Fig. 8 C). Acest lucru a sugerat că cei 47 aa au determinat distribuția nucleară. Acest lucru a fost confirmat prin fuzionarea segmentului 47-aa cu EGFP, care a devenit apoi exclusiv nuclear (Fig. 8 E). Inspecția segmentului 47-aa a relevat mai multe reziduuri de arginină care sugerează un semnal de localizare nucleară (NLS). Când ZBP2 de lungime completă a fost fuzionată cu GFP, cu sau fără segmentul 47-aa (Fig. 8, F și G), fluorescența nucleară a scăzut, dar nu a fost eliminată în construcție fără 47 aa, iar fluorescența citoplasmatică a crescut , indicând faptul că NLS slabe au existat cel mai probabil în altă parte a proteinei. Distribuția în fibroblaste pentru aceste ultime două construcții a fost cuantificată în neuroni și a dat aceleași procente de celule cu fluorescență citoplasmatică. Spre deosebire de ZBP2, KSRP uman a fost în întregime nuclear când a fost fuzionat cu GFP și exprimat în CEF (date nepublicate).

Distribuția nucleară versus citoplasmatică a ZBP2 în fibroblaste și neuroni. Structura genică a ZBP2 este demonstrată în A. Bara roșie, 47-aa inserare bare albastre, domenii KH bare gri, repetare COOH-terminală a motivului AWEEYYK. Diferitele construcții ale ZBP2 pe toată lungimea cu sau fără inserția 47-aa (F și G), inserția 47-aa (E), cele patru domenii KH (D), domeniul central conținând cele patru domenii KH și inserția 47-aa (C) sau capătul COOH al proteinei (B) au fost fuzionate cu GFP și s-a caracterizat distribuția celulară. Construcțiile sunt detaliate în panourile din stânga cu distribuții celulare în panourile din dreapta. Procentul de celule cu semnal citoplasmatic a fost caracterizat pentru fiecare construcție în numărul de sub fiecare construcție. Bare, 10 & # x003bcm.

Supraexprimarea domeniului central ZBP2 perturbă parțial și localizarea ARNm # x003b2-actină în CEF și neuroni

Un trunchiat al ZBP2, domeniul central, care conținea & # x0223c400 aa, inclusiv 47 aa cu patru domenii KH (Fig. 8 C), a fost transfectat în CEF. Am postulat că domeniile KH ar concura pentru legarea ARN-ului cu ZBP2 de lungime completă, analog cu ZBP1 (date nepublicate) și, prin urmare, ar acționa ca un negativ dominant pentru localizarea ARNm de & # x003b2-actină. Semnalul EGFP în fibroblastele transfectate cu trunchiatul a fost prezent în principal în nucleu. Localizarea ARNm-ului & # x003b2-actinei a fost vizualizată prin hibridizare fluorescentă in situ. Procentul de celule cu ARNm localizat de & # x003b2-actină a scăzut aproximativ la jumătate în CEF-urile transfectate (Fig. 9, sus) în contrast cu celulele transfectate cu EGFP sau EGFP-KSRP ca martor (omologul ZBP2 uman). Intensitatea semnalului citoplasmatic al mRNA & # x003b2-actină nu s-a modificat semnificativ, indicând faptul că exportul nuclear al mRNA & # x003b2-actină nu a fost inhibat de constructul negativ dominant (date nepublicate). În neuronii în curs de dezvoltare transfectați, această trunchiere a cauzat, de asemenea, o scădere cu 35% a semnalului mARN de & # x003b2-actină în procese sau conuri de creștere, comparativ cu experimentul de control (Fig. 9, mijloc). Acest lucru a sugerat că supraexprimarea ZBP2 trunchiată, dar încă nucleară, a afectat localizarea ARNm & # x003b2-actină. Pentru a demonstra că efectul negativ dominant al trunchiatului ZBP2 este specific, am efectuat cotransfecții atât ale ZBP2 de lungime completă, cât și ale domeniului central în CEF. Delocalizarea ARNm-actinei & # x003b2 în celulele transfectate a fost parțial salvată utilizând ZBP2 de tip sălbatic (Fig. 9, jos).

Un construct negativ dominant ZBP2 suprimă & # x003b2-localizarea ARNm a actinei. (Sus) Procentul de CEF transfectate cu ARNm localizat & # x003b2-actin. CEF-urile au fost transfectate timp de 6 ore urmate de fluorescență hibridizare in situ. Celulele transfectate au fost punctate pentru localizarea ARNm & # x003b2-actină. GFP, vector pEGFPC1 GFP-CD, GFP fuzionat cu domeniul central GFP-KSRP, GFP-KSRP uman Mock, fără plasmidă. Barele arată procentul de celule transfectate cu ARNm localizat & # x003b2-actină în fiecare experiment. Au fost numărate cel puțin 50 de celule transfectate în fiecare lamă de acoperire, câte două experimente fiecare. (Mijlociu) Semnalul ARNm de & # x003b2-actină în procesele neuronale. Experimentele au fost paralele cu A, cu excepția faptului că a fost utilizat terminalul COOH al ZBP2 (GFP-CT) (Fig. 8, construct B). Semnalul ARNm de & # x003b2-actină a fost măsurat și apoi transformat în unități de fluorescență. (Jos) Procentul de CEF cotransfectate cu ARNm localizat & # x003b2-actin. CEF-urile au fost transfectate fie cu o singură construcție (ZBP2 de tip sălbatic sau constructul dominant cu domeniu central negativ) sau ambele constructe cu rapoarte diferite (negativ dominant vs de tip sălbatic 1: 1 sau 1: 4) timp de 6 ore. După FISH, celulele transfectate au fost punctate ca în Fig. 9 A.


Suntem recunoscători pentru finanțarea primită de Centrul de excelență SymBioSys (Consiliul de cercetare KULeuven EF / 05/007), cercetarea de bază strategică a Institutului pentru promovarea inovației prin știință și tehnologie în Flandra, subvenția IWT-SBO 120050 ( NEMOA) și FWO [Fund for Scientific Research & # x02013 Flanders (Belgia)] printr-o bursă postdoctorală către HS.

Aiba, H. (2007). Mecanismul de tăcere a ARN-ului prin ARN-uri mici care leagă Hfq. Curr. Opin. Microbiol. 10, 134 și # x02013139. doi: 10.1016 / j.mib.2007.03.010

Anderson, P. E., Gober J. W. (2000). FlbT, regulatorul post-transcripțional al sintezei flagelinei în Caulobacter crescentus, interacționează cu regiunea netradusă 5 & # x02019 a mARN-ului flagelinei. Mol. Microbiol. 38, 41 și # x0201352. doi: 10.1046 / j.1365-2958.2000.02108.x

Arthur, D. C., Ghetu, A. F., Gubbins, M. J., Edwards, R. A., Frost, L. S. și Glover, J. N. M. (2003). FinO este un chaperon de ARN care facilitează interacțiunile ARN sens-antisens. EMBO J. 22, 6346 și # x020136355. doi: 10.1093 / emboj / cdg607

Aymerich, S. și Steinmetz, M. (1992). Determinanți de specificitate și caracteristici structurale în ținta ARN a proteinelor bacteriene antiterminatoare din familia BglG / SacY. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 89, 10410 și # x0201310414. doi: 10.1073 / pnas.89.21.10410

Babitzke, P. (2004). Reglarea atenuării transcripției și inițierea traducerii prin control alosteric al unei proteine ​​care leagă ARN: Bacillus subtilis Proteina TRAP. Curr. Opin. Microbiol. 7, 132 și # x02013139. doi: 10.1016 / j.mib.2004.02.003

Babitzke, P., Bear, D. G. și Yanofsky, C. (1995). TRAP, proteina de atenuare care leagă ARN-ul trp al Bacillus subtilis, este o moleculă în formă de toroid care leagă transcrierile care conțin repetări GAG sau UAG separate de două nucleotide. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 92, 7916 și # x020137920. doi: 10.1073 / pnas.92.17.7916

Babitzke, P., Stults, J. T., Shire, S. J. și Yanofsky, C. (1994). TRAP, proteina de atenuare care leagă ARN-ul trp al Bacillus subtilis, este un complex multisubunitar care pare să recunoască repetările G / UAG în transcrierile trpEDCFBA și trpG. J. Biol. Chem. 269, 16597 și # x0201316604.

Bachem, S. și St & # x000FClke, J. (1998). Regulamentul Bacillus subtilis Proteina antiterminatoare GlcT de către componentele sistemului fosfotransferazei. J. Bacteriol. 180, 5319 și # x020135326.

Bae, W., Xia, B., Inouye, M. și Severinov, K. (2000). Escherichia coli Chaperonele ARN din familia CspA sunt antiterminatoare ale transcripției. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 97, 7784 și # x020137789. doi: 10.1073 / pnas.97.14.7784

Baker, C. S., E & # x000F6ry, L. A., Yakhnin, H., Mercante, J., Romeo, T. și Babitzke, P. (2007). CsrA inhibă inițierea traducerii de Escherichia coli hfq prin legarea la un singur site care se suprapune secvenței Shine-Dalgarno. J. Bacteriol. 189, 5472 și # x020135481. doi: 10.1128 / JB.00529

Baker, C. S., Morozov, I., Suzuki, K., Romeo, T. și Babitzke, P. (2002). CsrA reglează biosinteza glicogenului prin împiedicarea traducerii glgC în Escherichia coli. Mol. Microbiol. 44, 1599 și # x020131610. doi: 10.1046 / j.1365-2958.2002.02982.x

Barria, C., Malecki, M. și Arraiano, C. M. (2013). Adaptarea bacteriană la frig. Microbiologie 159, 2437 și # x020132443. doi: 10.1099 / mic.0.052209-0

Beyer, D., Skripkin, E., Wadzack, J. și Nierhaus, K. H. (1994). Cum se mișcă ribozomul de-a lungul ARNm în timpul sintezei proteinelor. J. Biol. Chem. 269, 30713 și # x0201330717.

Brencic, A. și Lory, S. (2009). Determinarea regulonului și identificarea noilor ținte de mARN de Pseudomonas aeruginosa RsmA. Mol. Microbiol. 72, 612 și # x02013632. doi: 10.1111 / j.1365-2958.2009.06670.x

Browne, P., Barret, M., O & # x02019 Gara, F. și Morrissey, J. P. (2010). Predicția computerizată a regulonului Crc identifică țintele la nivel de gen și speciile specifice de control al represiunii catabolite în Pseudomonas bacterii. BMC Microbiol. 10: 300. doi: 10.1186 / 1471-2180-10-300

Burrowes, E., Baysse, C., Adams, C. și O & # x02019 Gara, F. (2006). Influența proteinei de reglementare RsmA asupra funcțiilor celulare în Pseudomonas aeruginosa PAO1, după cum a fost relevat de analiza transcriptomului. Microbiologie 152, 405 și # x02013418. doi: 10.1099 / mic.0.28324-0

Callaghan, A. J., Marcaida, M. J., Stead, J. A., McDowall, K. J., Scott, W. G. și Luisi, B. F. (2005). Structura Escherichia coli Domeniul catalitic al RNase E și implicații pentru rotirea ARN. Natură 437, 1187 și # x020131191. doi: 10.1038 / nature04084

Carpousis, A. J. (2007). ARN-ul degradant al Escherichia coli: o mașină care degradează ARNm asamblată pe RNaza E. Annu. Pr. Microbiol. 61, 71 și # x0201387. doi: 10.1146 / annurev.micro.61.080706.093440

Chai, W. și Stewart, V. (1999). Cerințe privind secvența ARN pentru antiterminarea transcripției mediată de NasR, receptivă la nitrați Klebsiella oxytoca Lider operon nas5 M5al. J. Mol. Biol. 292, 203 și # x02013216. doi: 10.1006 / jmbi.1999.3084

Chaulk, S., Lu, J., Tan, K., Arthur, D. C., Edwards, R. A., Frost, L. S. și colab. (2010). N. meningitidis 1681 este membru al familiei FinO a șoferilor de ARN. ARN Biol. 7, 812 și # x02013819. doi: 10.4161 / rna.7.6.13688

Chaulk, S. G., Smith-Frieday, M. N., Arthur, D. C., Culham, D. E., Edwards, R. A., Soo, P., și colab. (2011). ProQ este un șofer de ARN care controlează nivelurile ProP în Escherichia coli. Biochimie 50, 3095 și # x020133106. doi: 10.1021 / bi101683a

Chen, Y. și Anderson, D. M. (2011). Ierarhia expresiei în Yersinia sistem de secreție de tip III stabilit prin recunoașterea YopD a ARN-ului. Mol. Microbiol. 80, 966 și # x02013980. doi: 10.1111 / j.1365-2958.2011.07623.x

Christiansen, J. K., Larsen, M. H., Ingmer, H., S & # x000F8gaard-andersen, L. și Kallipolitis, B. H., (2004). Proteina Hfq de legare a ARN a Listeria monocytogenes: rol în toleranța la stres și virulență. J. Bacteriol. 186, 3355 și # x020133362. doi: 10.1128 / JB.186.11.3355-3362.2004

Cohen-Or, I., Shenhar, Y., Biran, D. și Ron, E. Z. (2010). CspC reglează nivelurile de transcriere rpoS și completează ștergerile hfq. Rez. Microbiol. 161, 694 și # x02013700. doi: 10.1016 / j.resmic.2010.06.009

Davies, B. W., K & # x000F6hrer, C., Jacob, A. I., Simmons, L. A., Zhu, J., Aleman, L. M., și colab. (2011). Rolul Escherichia coli YbeY, o proteină foarte conservată, în procesarea ARNr. Mol. Microbiol. 78, 506 și # x02013518. doi: 10.1111 / j.1365-2958.2010.07351.x

Deana, A. și Belasco, J. G. (2005). Pierdut în traducere: influența ribozomilor asupra degradării ARNm bacterian. Gene Dev. 19, 2526 & # x020132533. doi: 10.1101 / gad.1348805

De Lay, N., Schu, D. J. și Gottesman, S. (2013). Reglare negativă bacteriană pe bază de ARN mic: Hfq și complicii săi. J. Biol. Chem. 288, 7996 și # x020138003. doi: 10.1074 / jbc.R112.441386

Desnoyers, G., Bouchard, M. P. și Mass & # x000E9, E. (2013). Noi perspective asupra reglării translaționale mici ARN-dependente la procariote. Trends Genet. 29, 92 și # x0201398. doi: 10.1016 / j.tig.2012.10.004

Desnoyers, G. și Masse, E. (2012). Represiunea necanonică a inițierii traducerii prin recrutarea ARN-ului mic al HFq-ului chaperonei ARN. 42, 726 și # x02013739. doi: 10.1101 / gad.182493.111

Du, H. și Babitzke, P. (1998). atenuarea de legare a ARN-ului trp, refoldarea ARN-ului la distanță lungă, mediată de proteine ​​reglează traducerea trpE în Bacillus subtilis. J. Biol. Chem. 273, 20494 și # x0201320503. doi: 10.1074 / jbc.273.32.20494

Du, H., Tarpey, R. și Babitzke, P. (1997). Proteina de atenuare a legării ARN trp reglează sinteza TrpG prin legarea la locul de legare a ribozomului trpG al Bacillus subtilis. J. Bacteriol. 179, 2582 și # x020132586.

Dubey, A. K., Baker, C. S., Romeo, T. și Babitzke, P. (2005). Secvența de ARN și structura secundară participă la interacțiunea cu ARN de mare afinitate CsrA & # x02013. ARN 11, 1579 & # x020131587. doi: 10.1261 / rna.2990205.3

Dubey, A. K., Baker, C. S., Suzuki, K., Jones, A. D., Pandit, P., Romeo, T., și colab. (2003). CsrA reglementează traducerea fișierului Escherichia coli gena foametei de carbon, cstA, prin blocarea accesului ribozomului la transcriptul cstA. J. Bacteriol. 185, 4450 și # x020134460. doi: 10.1128 / JB.185.15.4450-4460.2003

Edwards, A. N., Patterson-Fortin, L. M., Vakulskas, C. A., Mercante, J.W., Potrykus, K., Vinella, D., și colab. (2011). Circuite care leagă CSR și sistemele de reglementare globale de răspuns strict. Mol. Microbiol. 80, 1561 și # x020131580. doi: 10.1111 / j.1365-2958.2011.07663.x

Chiar, S., Pellegrini, O., Zig, L., Labas, V., Vinh, J., Br & # x000E9chemmier-Baey, D., și colab. (2005). Ribonucleaze J1 și J2: două endoribonucleaze noi în B. subtilis cu omologie funcțională la E coli RNase E. Acizi nucleici Res. 33, 2141 și # x020132152. doi: 10.1093 / nar / gki505

Feng, Y., Huang, H., Liao, J. și Cohen, S. N. (2001). Escherichia coli proteine ​​care leagă poli (A) care interacționează cu componentele degradosomilor sau împiedică degradarea ARN mediate de polinucleotid fosforilaza și RNaza E. J. Biol. Chem. 276, 31651 și # x0201331656. doi: 10.1074 / jbc.M102855200

Ferooz, J., Lemaire, J. și Letesson, J.-J. (2011). Rolul FlbT în producția de flagelină în Brucella melitensis. Microbiologie 157, 1253 și # x020131262. doi: 10.1099 / mic.0.044867-0

Figueroa-Bossi, N., Schwartz, A., Guillemardet, B., D & # x02019Heyg & # x000E8re, F., Bossi, L. și Boudvillain, M. (2014). Remodelarea ARN de către regulatorul global bacterian CsrA promovează terminarea transcripției dependente de Rho. Gene Dev. 28, 1239 și # x020131251. doi: 10.1101 / gad.240192.114

Finn, R. D., Bateman, A., Clements, J., Coggill, P., Eberhardt, R. Y., Eddy, S. R., și colab. (2014). Pfam: baza de date a familiilor de proteine. Acizi nucleici Res. 42, D222 & # x02013D2230. doi: 10.1093 / nar / gkt1223

Folichon, M. (2003). Proteina de legare poli (A) Hfq protejează ARN de RNaza E și degradarea exoribonucleolitică. Acizi nucleici Res. 31, 7302 & # x020137310. doi: 10.1093 / nar / gkg915

Gaballa, A., Antelmann, H., Aguilar, C., Khakh, S. K., Song, K.-B., Smaldone, G. T., și colab. (2008). The Bacillus subtilis răspunsul de economisire a fierului este mediat de un ARN mic reglementat de blană și de trei proteine ​​mici, de bază. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 105, 11927 și # x0201311932. doi: 10.1073 / pnas.0711752105

Geissmann, T. A. și Touati, D. (2004). Hfq, un nou rol de coordonare: legarea la ARN mesager determină accesul pentru regulatorul de ARN mic. EMBO J. 23, 396 și # x02013405. doi: 10.1038 / sj.emboj.7600058

Gollnick, P., Babitzke, P., Antson, A. și Yanofsky, C. (2005). Complexitatea în reglarea biosintezei triptofanului în Bacillus subtilis. Annu. Pr. Genet. 39, 47 și # x0201368. doi: 10.1146 / annurev.genet.39.073003.093745

G & # x000F6pel, Y., Papenfort, K., Reichenbach, B., Vogel, J. și G & # x000F6rke, B. (2013). Dezintegrarea vizată a unui ARN mic de reglementare de către o proteină adaptoare pentru RNaza E și contracararea de către un ARN anti-adaptor. Gene Dev. 27, 552 & # x02013564. doi: 10.1101 / gad.210112.112

Hajnsdorf, E. și Boni, I. V. (2012). Activități multiple ale proteinelor de legare a ARN-ului S1 și Hfq. Biochimie 94, 1544 și # x020131553. doi: 10.1016 / j.biochi.2012.02.010

Hajnsdorf, E. și R & # x000E9gnier, P. (2000). Factorul gazdă Hfq al Escherichia coli stimulează alungirea cozilor poli (A) prin poli (A) polimeraza I. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 97, 1501 și # x020131505. doi: 10.1073 / pnas.040549897

H & # x000E4mmerle, H., Amman, F., Ve & # x000E8erek, B., St & # x000FClke, J., Hofacker, I. și Bl & # x000E4si, U. (2014). Impactul Hfq asupra Bacillus subtilis transcriptom. Plus unu 9: e98661. doi: 10.1371 / journal.pone.0098661

Henderson, C. A., Vincent, H. A., Casamento, A., Stone, C. M., Phillips, J. O., Cary, P. D., și colab. (2013). Legarea Hfq modifică structura Escherichia coli ARN-uri mici necodificate OxyS și RprA, care sunt implicate în riboreglarea rpoS. ARN 19, 1089 & # x020131104. doi: 10.1261 / rna.034595.112

Herschlag, D. (1995). Chaperonii ARN și problema plierii ARN. J. Biol. Chem. 270, 20871 și # x0201320874. doi: 10.1074 / jbc.270.36.20871

Hopkins, J. F., Panja, S. și Woodson, S. A. (2011). Legarea rapidă și eliberarea Hfq din complexele ternare în timpul recoacerii ARN. Acizi nucleici Res. 39, 5193 și # x020135202. doi: 10.1093 / nar / gkr062

Huttenhofer, A. și Fnolier, H. (1994). Amprentarea complexelor de ARNm-ribozomi cu sonde chimice. EMBO J. 13, 3892 și # x020133901.

Ikeda, Y., Yagi, M., Morita, T. și Aiba, H. (2011). Legarea Hfq la regiunea de recunoaștere RhlB a RNazei E este crucială pentru degradarea rapidă a mARN-urilor țintă mediate de ARNs în Escherichia coli. Mol. Microbiol. 79, 419 și # x02013432. doi: 10.1111 / j.1365-2958.2010.07454.x

Irie, Y., Starkey, M., Edwards, A. N., Wozniak, D. J., Romeo, T. și Parsek, M. R. (2010). Pseudomonas aeruginosa matricea biofilmului polizaharidă Psl este reglată transcripțional de RpoS și post-transcripțional de RsmA. Mol. Microbiol. 78, 158 și # x02013172. doi: 10.1111 / j.1365-2958.2010.07320.x

Jacob, A. I., K & # x000F6hrer, C., Davies, B. W., Rajbhandary, U. L. și Walker, G. C. (2014). RNase YbeY bacteriană conservată joacă roluri cheie în controlul calității ribozomilor 70S și maturarea ARNr 16S. Mol. Celula 49, 427 și # x02013438. doi: 10.1016 / j.molcel.2012.11.025

Jerome, L. J., van Biesen, T. și Frost, L. S. (1999). Degradarea ARN antisens FinP din plasmidele asemănătoare F: proteina care leagă ARN, FinO, protejează FinP de ribonuclează E. J. Mol. Biol. 285, 1457 și # x020131473. doi: 10.1006 / jmbi.1998.2404

Jonas, K., Edwards, A. N., Simm, R., Romeo, T., R & # x000F6mling, U. și Melefors, O. (2008). Proteina de legare a ARN-ului CsrA controlează metabolismul ciclic di-GMP prin reglarea directă a expresiei proteinelor GGDEF. Mol. Microbiol. 70, 236 și # x02013257. doi: 10.1111 / j.1365-2958.2008.06411.x

J & # x000F8rgensen, M. G., Thomason, M. K., Havelund, J., Valentin-Hansen, P. și Storz, G. (2013). Funcția duală a ARN-ului mic McaS în controlul formării biofilmului. Gene Dev. 27, 1132 și # x020131145. doi: 10.1101 / gad.214734.113

Jutras, B. L., Chenail, A. M., Carroll, D. W., Miller, M. C., Zhu, H., Bowman A., și colab. (2013a). Bpur, spirocheta bolii Lyme și proteina domeniului PUR # x02019s: identificarea ca modulator transcripțional și caracterizarea interacțiunilor cu acidul nucleic. J. Biol. Chem. 288, 26220 și # x0201326234. doi: 10.1074 / jbc.M113.491357

Jutras, B. L., Jones, G. S., Verma, A., Brown, N. A., Antonicello, A. D., Chenail, A. M., și colab. (2013b). Autoreglare posttranscripțională de către bacteria bolii Lyme & # x02019s BpuR ADN / ARN-binding protein. J. Bacteriol. 195, 4915 și # x020134923. doi: 10.1128 / JB.00819-13

Kaberdin, V. R., Singh, D. și Lin-Chao, S. (2011). Compoziția și conservarea mașinilor care degradează ARNm la bacterii. J. Biomed. Știință. 18, 23. doi: 10.1186 / 1423-0127-18-23

Kawamoto, H., Koide, Y., Morita, T. și Aiba, H. (2006). Cerință de asociere a bazelor pentru reducerea ARN-ului de către un ARN bacterian mic și accelerarea formării duplexului de către Hfq. Mol. Microbiol. 61, 1013 și # x020131022. doi: 10.1111 / j.1365-2958.2006.05288.x

Kime, L., Jourdan, S. S., Stead, J. A., Hidalgo-Sastre, A. și McDowall, K. J. (2010). Scindarea rapidă a ARN-ului de către RNaza E în absența stimulării monofosfatului 5 & # x02019. Mol. Microbiol. 76, 590 și # x02013604. doi: 10.1111 / j.1365-2958.2009.06935.x

Koleva, R. I., Austin, C. A., Kowaleski, J. M., Neems, D. S., Wang, L., Vary, C. P. H., și colab. (2006). Interacțiuni ale proteinei ribozomale S1 cu DsrA și ARNp rpoS. Biochimie. Biofizi. Rez. Comun. 348, 662 și # x02013668. doi: 10.1016 / j.bbrc.2006.07.102

Komarova, A. V., Tchufistova, L. S., Dreyfus, M. și Boni, I. V. (2005). Secvențe bogate în AU în 5 & # x02019 lideri netraduși îmbunătățesc traducerea și stabilizează ARNm în Escherichia coli. J. Bacteriol. 187, 1344 și # x020131349. doi: 10.1128 / JB.187.4.1344

Kopaskie, K. S., Ligtenberg, K. G. și Schneewind, O. (2013). Reglementarea translațională a Yersinia enterocolitica ARNm care codifică un substrat de secreție de tip III. J. Biol. Chem. 288, 35478 și # x0201335488. doi: 10.1074 / jbc.M113.504811

Kovach, A. R., Hoff, K. E., Canty, J. T., Orans, J. și Brennan, R. G. (2014). Recunoașterea ARN-ului bogat în U de către Hfq de la agentul patogen Gram-pozitiv Listeria monocytogenes. ARN 20, 1548 și # x020131559. doi: 10.1261 / rna.044032.113

Kulkarni, P. R., Cui, X., Williams, J. W., Stevens, A. M. și Kulkarni, R. V. (2006). Predicția ARN-urilor mici care reglementează CsrA la bacterii și verificarea lor experimentală în Vibrio fischeri. Acizi nucleici Res. 34, 3361 și # x020133369. doi: 10.1093 / nar / gkl439

Lawhon, S. D., Frye, J. G., Suyemoto, M., Porwollik, S., McClelland, M. și Altier, C. (2003). Reglementare globală de către CsrA în Salmonella typhimurium. Mol. Microbiol. 48, 1633 și # x020131645. doi: 10.1046 / j.1365-2958.2003.03535.x

Le Derout, J. (2003). Hfq afectează lungimea și frecvența cozilor scurte de oligo (A) la sfârșitul 3 & # x02019 Escherichia coli ARNm rpsO. Acizi nucleici Res. 31, 4017 și # x020134023. doi: 10.1093 / nar / gkg456

Le Derout, J., Boni, I. V., R & # x000E9gnier, P. și Hajnsdorf, E. (2010). Hfq afectează nivelurile de ARNm independent de degradare. BMC Mol. Biol. 11:17. doi: 10.1186 / 1471-2199-11-17.

Link, T. M., Valentin-Hansen, P. și Brennan, R. G. (2009). Structura Escherichia coli Hfq legat de polirriboadenilat de ARN. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 106, 19292 și # x0201319297. doi: 10.1073 / pnas.0908744106

Liu, J. M. și Camilli, A. (2010). O lume în expansiune a ARN-urilor bacteriene mici. Curr. Opin. Microbiol. 13, 18 și # x0201323. doi: 10.1016 / j.mib.2009.11.004

Liu, M. Y., Gui, G., Wei, B., Preston, J. F., Oakford, L., Yuksel, U., și colab. (1997). Molecula de ARN CsrB se leagă de proteina de reglementare globală CsrA și îi antagonizează activitatea Escherichia coli. J. Biol. Chem. 272, 17502 și # x0201317510. doi: 10.1074 / jbc.272.28.17502

Liu, M. Y., Yang, H. și Romeo, T. (1995). Produsul pleiotropului Escherichia coli gena csrA modulează biosinteza glicogenului prin efecte asupra stabilității ARNm. J. Bacteriol. 177, 2663 și # x020132672.

Liu, Y., Wu, N., Dong, J., Gao, Y., Zhang, X., Mu, C., și colab. (2010). Hfq este un regulator global care controlează patogenitatea Staphylococcus aureus. Plus unu 5: 13069. doi: 10.1371 / journal.pone.0013069

Lorenz, C., Gesell, T., Zimmermann, B., Schoeberl, U., Bilusic, I., Rajkowitsch, L., și colab. (2010). SELEX genomic pentru ARN-uri care leagă Hfq identifică aptameri genomici predominant în transcrierile antisens. Acizi nucleici Res. 38, 3794 și # x020133808. doi: 10.1093 / nar / gkq032

Lu, Y., Turner, R. și Switzer, R. (1996). Funcția structurilor secundare de ARN în atenuarea transcripțională a Bacillus subtilis pyr operon. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 93, 14462 și # x0201314467. doi: 10.1073 / pnas.93.25.14462

Mackay, J. P., Font, J. și Segal, D. J. (2011). Perspectivele de proiectare a proteinelor monocatenare de legare a ARN-ului. Nat. Struct. Mol. Biol. 18, 256 & # x02013261. doi: 10.1038 / nsmb.2005

Mackie, G. A. (1998). Ribonucleaza E este o endonuclează dependentă de 5 & # x02019. Natură 395, 720 & # x02013723. doi: 10.1038 / 27246

Mackie, G. A. (2013). RNaza E: la interfața de procesare și descompunere a ARN-ului bacterian. Nat. Pr. Microbiol. 11, 45 și # x0201357. doi: 10.1038 / nrmicro2930

Mahadevan, S. și Wright, A. (1987). O genă bacteriană implicată în antiterminarea transcripției: reglarea la un terminator independent de rho în operonul bgl al E. coli. Celula 50, 485 și # x02013494. doi: 10.1016 / 0092-8674 (87) 90502-2

Mallory, A. și Vaucheret, H. (2010). Forma, funcția și reglarea proteinelor ARGONAUTE. Celula plantei 22, 3879 & # x020133889. doi: 10.1105 / tpc.110.080671

Marden, J. N., Diaz, M. R., Walton, W. G., Gode, C. J., Betts, L., Urbanowski, M. L. și colab. (2013). Un membru neobișnuit al familiei CsrA operează în serie cu RsmA pentru a amplifica răspunsurile posttranscripționale în Pseudomonas aeruginosa. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 110, 15055 și # x0201315060. doi: 10.1073 / pnas.1307217110

Mass & # x000E9, E., Escorcia, F. E. și Gottesman, S. (2003). Degradarea cuplată a unui ARN de reglementare mic și a obiectivelor sale de ARNm în Escherichia coli. Gene Dev. 19, 2374 & # x020132383. doi: 10.1101 / gad.1127103

Merino, E., Babitzke, P., Yanofsky, C., Merino, E., Babitzke, P. și Yanofsky, C. (1995). trp proteina de atenuare a legării ARN (TRAP) -trp lider interacțiunile ARN mediază translațional, precum și reglarea transcripțională a Bacillus subtilis trp operon. J. Bacteriol. 177, 6362 și # x020136370.

Mikulecky, P. J., Kaw, M. K., Brescia, C. C., Takach, J. C., Darren, D. și Feig, A. L. (2004). Escherichia coli Hfq are suprafețe de interacțiune distincte pentru DsrA, rpoS și poli (A) ARN-uri. Nat. Struct. Mol. Biol. 11, 1206 și # x020131214. doi: 10.1038 / nsmb858

Milojevic, T., Grishkovskaya, I., Sonnleitner, E., Djinovic-Carugo, K. și Bl & # x000E4si, U. (2013). The Pseudomonas aeruginosa proteina de control a represiunii catabolite Crc este lipsită de activitate de legare a ARN-ului. Plus unu 8: e64609. doi: 10.1371 / journal.pone.0064609

Mitobe, J., Yanagihara, I., Ohnishi, K., Yamamoto, S., Ohnishi, M., Ishihama, A., și colab. (2011). RodZ reglementează procesarea post-transcripțională a Shigella sonnei sistem de secreție de tip III. Rep. EMBO 12, 911 și # x02013916. doi: 10.1038 / embor.2011.132

Mohanty, B. K., Maples, V. F. și Kushner, S. R. (2004). Proteina Hfq asemănătoare Sm reglează degradarea ARNm dependentă de poliadenilare Escherichia coli. Mol. Microbiol. 54, 905 și # x02013920. doi: 10.1111 / j.1365-2958.2004.04337.x

Moll, I., Afonyushkin, T., Vytvytska, O. și Kaberdin, V. R. (2003). Situri de legare coincidente Hfq și de scindare a RNazei E pe ARNm și ARN-uri mici de reglare. ARN 11, 1308 și # x020131314. doi: 10.1261 / rna.5850703

M & # x000F8ller, T., Franch, T., H & # x000F8jrup, P., Keene, D. R., Ba, H. P., Brennan, R. G., și colab. (2002). Hfq: o proteină asemănătoare sm-ului bacterian care mediază interacțiunea ARN-ARN. Mol. Celula 9, 23 și # x0201330. doi: 10.1016 / S1097-2765 (01) 00436-1

Moreno, R., Hern & # x000E1ndez-Arranz, S., La Rosa, R., Yuste, L., Madhushani, A., Shingler, V., și colab. (2014). Proteinele Crc și Hfq ale Pseudomonas putida cooperează în reprimarea catabolită și formarea complexelor de acid ribonucleic cu motive țintă specifice. Mediu Microbiol. 17, 105 și # x02013118. doi: 10.1111 / 1462-2920.12499

Moreno, R., Marzi, S., Romby, P. și Rojo, F. (2009). Regulatorul global Crc se leagă de un motiv nepereche bogat în A la Pseudomonas putida alcS secvență de codificare a ARNm și inhibă inițierea traducerii. Acizi nucleici Res. 37, 7678 și # x020137690. doi: 10.1093 / nar / gkp825

Morita, T., Maki, K. și Aiba, H. (2005). Complexe de ribonucleoproteine ​​pe bază de RNază E: bază mecanică a destabilizării ARNm mediată de ARN-uri bacteriene necodificate. Gene Dev. 19, 2176 și # x020132186. doi: 10.1101 / gad.1330405.1996

Morris, E. R., Hall, G., Li, C., Heeb, S., Kulkarni, R. V., Lovelock, L., și colab. (2013). Rearanjare structurală într-un Ortholog RsmA / CsrA al pseudomonas aeruginosa creează o proteină dimerică de legare a ARN, RsmN. Structura 21, 1659 și # x020131671. doi: 10.1016 / j.str.2013.07.007

Mu & # x0FB04er, A., Fischer, D. și Hengge-Aronis, R. (1996). Proteina de legare a ARN-ului HF-I, cunoscută ca factor gazdă pentru replicarea ARN-ului fag Qbeta, este esențială pentru traducerea rpoS în Escherichia coli. Gene Dev. 10, 1143 și # x020131151. doi: 10.1101 / gad.10.9.1143

Mukherjee, S., Yakhnin, H., Kysela, D., Sokoloski, J., Babitzke, P. și Kearns, D. B. (2011). Interacțiunea CsrA-FliW guvernează homeostazia flagelinei și un punct de control asupra morfogenezei flagelare în Bacillus subtilis. Mol. Microbiol. 82, 447 și # x02013461. doi: 10.1111 / j.1365-2958.2011.07822.x

Muto, Y., Oubridge, C. și Nagai, K. (2000). Proteine ​​care leagă ARN: captarea bazelor ARN. Curr. Biol. 10, 19 și # x0201321. doi: 10.1016 / S0960-9822 (99) 00250-X

Osborne, J., Djapgne, L., Tran, B. Q., Goo, Y. A. și Oglesby-Sherrouse, A. G. (2014). O metodă pentru identificarea in vivo a proteinelor bacteriene mici care leagă ARN-ul. Microbiologie deschis 3, 950 și # x02013960. doi: 10.1002 / mbo3.220

Pandey, P, S., Winkler, J. A., Li, H., Camacho, D. M., Collins, J. J. și Walker, G. C. (2014). Rolul central al RNase YbeY în reglarea ARN-ului mic dependentă de Hfq și independentă de Hfq la bacterii. BMC Genomics 15: 121. doi: 10.1186 / 1471-2164-15-121

Pandey, S. P., Minesinger, B. K., Kumar, J. și Walker, G. C. (2011). O proteină foarte conservată, cu funcție necunoscută în Sinorhizobium meliloti, afectează reglarea ARNm similar cu Hfq. Acizi nucleici Res. 39, 4691 și # x020134708. doi: 10.1093 / nar / gkr060

Patterson-Fortin, L. M., Vakulskas, C. A., Yakhnin, H., Babitzke, P. și Romeo, T. (2013). Reglare dublă posttranscripțională printr-un lider de ARNm care răspunde la cofactor. J. Mol. Biol. 425, 3662 și # x020133677. doi: 10.1016 / j.jmb.2012.12.010

Perez-Rueda, E. și Martinez-Nu & # x000F1ez, M. A. (2012). Repertoriul factorilor de transcripție care leagă ADN în procariote: lecții funcționale și evolutive. Știință. Prog. 95, 315 și # x02013329. doi: 10.3184 / 003685012X13420097673409

Phadtare, S., Inouye, M. și Severinov, K. (2002). Activitatea de topire a acidului nucleic a Escherichia coli CspE este esențial pentru antiterminarea transcripției și aclimatizarea la rece a celulelor. J. Biol. Chem. 277, 7239 și # x020137245. doi: 10.1074 / jbc.M111496200

Picard, F., Dressaire, C., Girbal, L. și Cocaign-Bousquet, M. (2009).Examinarea reglementărilor post-transcripționale în procariote prin biologie integrativă. C. R. Biol. 332, 958 și # x02013973. doi: 10.1016 / j.crvi.2009.09.005

Rabhi, M., Esp & # x000E9li, O., Schwartz, A., Cayrol, B., Rahmouni, A. R., Arluison, V., și colab. (2011). Hfq de chaperonă de ARN asemănător Sm mediază antiterminarea transcripției la terminatorii dependenți de Rho. EMBO J. 30, 2805 și # x020132816. doi: 10.1038 / emboj.2011.192

Ramesh, A., DebRoy, S., Goodson, J. R., Fox, K. A., Faz, H., Garsin, D. A. și colab. (2012). Mecanismul pentru recunoașterea ARN de către regulatorii ANTAR ai expresiei genelor. PLoS Genet. 8: e1002666. doi: 10.1371 / journal.pgen.1002666

Rasmussen, A. A., Eriksen, M., Gilany, K., Udesen, C., Franch, T., Petersen, C., și colab. (2005). Reglarea stabilității mARN-ului ompA: rolul unui ARN regulator mic în controlul dependent de faza de creștere. Mol. Microbiol. 58, 1421 și # x020131429. doi: 10.1111 / j.1365-2958.2005.04911.x

R & # x000E9gnier, P. și Hajnsdorf, E. (2013). Interacțiunea Hfq, poli (A) polimerază I și exoribonucleaze la capetele 3 & # x02019 ale ARN-urilor rezultate din terminarea independentă de Rho: un model provizoriu. ARN Biol. 10, 602 și # x02013609. doi: 10.4161 / rna.23664

Reimmann, C., Valverde, C., Kay, E. și Haas, D. (2005). Represiunea posttranscripțională a genelor controlate de GacS / GacA de către proteina de legare a ARN-ului RsmE care acționează împreună cu RsmA în tulpina de biocontrol Pseudomonas fluorescens CHA0. J. Bacteriol. 187, 276 și # x02013285. doi: 10.1128 / JB.187.1.276

Rieder, R., Reinhardt, R., Sharma, C. și Vogel, J. (2012). Instrumente experimentale pentru identificarea interacțiunilor ARN-proteină în Helicobacter pylori. ARN Biol. 9, 520 și # x02013531. doi: 10.4161 / rna.20331

Romeo, T., Vakulskas, C. A. și Babitzke, P. (2013). Reglarea post-transcripțională la scară globală: forma și funcția sistemelor Csr / Rsm. Mediu Microbiol. 15, 313 și # x02013324. doi: 10.1111 / j.1462-2920.2012.02794.x

Rutberg, B. (1997). MicroReview antiterminarea transcrierii operonilor catabolici. Mol. Microbiol. 23, 413 și # x02013421. doi: 10.1046 / j.1365-2958.1997.d01-1867.x

Said, N., Rieder, R., Hurwitz, R., Deckert, J., Urlaub, H. și Vogel, J. (2009). Exprimarea și purificarea in vivo a regulatorilor de ARN mici marcați cu aptamer. Acizi nucleici Res. 37, e133. doi: 10.1093 / nar / gkp719

Salvail, H., Caron, M.-P., B & # x000E9langer, J. și Mass & # x000E9, E. (2013). Funcțiile antagonice dintre Hfq de chaperonă de ARN și un ARNm reglează sensibilitatea la antibioticul colicină. EMBO J. 32, 2764 și # x020132778. doi: 10.1038 / emboj.2013.205

Santangelo, T. J. și Artsimovitch, I. (2011). Terminare și antiterminare: ARN polimeraza rulează un semn de oprire. Nat. Pr. Microbiol. 9, 319 și # x02013329. doi: 10.1038 / nrmicro2560

Saramago, M., B & # x000E1rria, C., Dos Santos, R. F., Silva, I. J., Pobre, V., Domingues, S., și colab. (2014). Rolul RNazelor în reglarea ARN-urilor mici. Curr. Opin. Microbiol. 18, 105 și # x02013115. doi: 10.1016 / j.mib.2014.02.009

Sarsero, J. P., Merino, E. și Yanofsky, C. (2000). A Bacillus subtilis gena funcției necunoscute anterior, yhaG, este reglată translațional prin TRAP activat cu triptofan și pare a fi implicată în transportul triptofanului. J. Bacteriol. 182, 2329 și # x020132331. doi: 10.1128 / JB.182.8.2329-2331.2000

Sauer, E. (2013). Structura și proprietățile de legare a ARN-ului proteinei LSm bacteriene Hfq. ARN Biol. 10, 610 și # x02013618. doi: 10.4161 / rna.24201

Sauer, E., Schmidt, S. și Weichenrieder, O. (2012). ARN mic care se leagă de suprafața laterală a hexamerilor Hfq și rearanjări structurale la recunoașterea țintei ARNm. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 109, 9396 și # x020139401. doi: 10.1073 / pnas.1202521109

Schiano, C. A. și Lathem, W. W. (2012). Reglarea post-transcripțională a expresiei genelor în Yersinia specii. Față. Celula. Infecta. Microbiol. 2: 129. doi: 10.3389 / fcimb.2012.00129

Schnetz, K. și Rak, B. (1988). Reglarea operonului bgl al Escherichia coli prin antiterminare transcripțională. EMBO J. 7, 3271 și # x020133277.

Schumacher, M. A., Pearson, R. F., M & # x000F8ller, T., Valentin-Hansen, P. și Brennan, R. G. (2002). Structuri ale regulatorului translațional pleiotrop Hfq și ale unui complex Hfq-ARN: o proteină asemănătoare Sm-ului bacterian. EMBO J. 21, 3546 și # x020133556. doi: 10.1093 / emboj / cdf322

Shahbabian, K., Jamalli, A., Zig, L. și Putzer, H. (2009). RNase Y, o nouă endoribonuclează, inițiază rotația riboswitch în Bacillus subtilis. EMBO J. 28, 3523 și # x020133533. doi: 10.1038 / emboj.2009.283

Sheidy, D. T. și Zielke, R. A. (2013). Analiza și extinderea rolului Escherichia coli proteine ​​ProQ. Plus unu 8: e79656. doi: 10.1371 / journal.pone.0079656

Shine, J. și Dalgarno, L. (1974). Secvența 3 & # x02019-terminal a Escherichia coli ARN ribozomal 16S: complementaritate cu triplete fără sens și situsuri de legare a ribozomilor. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 71, 1342 și # x020131346. doi: 10.1073 / pnas.71.4.1342

Smaldone, G. T., Antelmann, H., Gaballa, A. și Helmann, J. D. (2012). Arsna FsrA și proteina FbpB mediază inducția dependentă de fier a Bacillus subtilis lutABC oxidaze care conțin fier-sulf. J. Bacteriol. 194, 2586 și # x020132593. doi: 10.1128 / JB.05567-11

Snyder, D., Lary, J., Chen, Y., Gollnick, P. și Cole, J. L. (2004). Interacțiunea proteinei de atenuare care leagă ARN-ul trp (TRAP) cu anti-TRAP. J. Mol. Biol. 338, 669 și # x02013682. doi: 10.1016 / j.jmb.2004.03.030

Sobrero, P. și Valverde, C. (2012). Proteina bacteriană Hfq: mult mai mult decât un simplu factor de legare a ARN-ului. Crit. Pr. Microbiol. 38, 276 și # x02013299. doi: 10.3109 / 1040841X.2012.664540

Sonnleitner, E., Abdou, L. și Haas, D. (2009). ARN mic ca regulator global al represiunii catabolitului de carbon în Pseudomonas aeruginosa. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 106, 21866 și # x0201321871. doi: 10.1073 / pnas.pnas.0910308106

Sonnleitner, E. și Bl & # x000E4si, U. (2014). Reglarea Hfq de către ARN CrcZ în Pseudomonas aeruginosa reprimarea catabolitului de carbon. PLoS Genet. 10: e1004440. doi: 10.1371 / journal.pgen.1004440

Soper, T. J., Doxzen, K. și Woodson, S. A. (2011). Rol major pentru legarea și restructurarea ARNm în recrutarea ARNm de către Hfq. ARN 17, 1544 și # x020131550. doi: 10.1261 / rna.2767211

Sorger-Domenigg, T., Sonnleitner, E., Kaberdin, V. R. și Bl & # x000E4si, U. (2007). Situri de legare distincte și suprapuse ale Pseudomonas aeruginosa Proteine ​​Hfq și RsmA pe ARN-ul necodificat RsmY. Biochimie. Biofizi. Rez. Comun. 352, 769 și # x02013773. doi: 10.1016 / j.bbrc.2006.11.084

Sterzenbach, T., Nguyen, K. T., Nuccio, S.-P., Winter, M. G., Vakulskas, C. A., Clegg, S., și colab. (2013). Un nou mecanism de titrare CsrA reglează expresia genei fimbriale în Salmonella typhimurium. EMBO J. 32, 2872 și # x020132883. doi: 10.1038 / emboj.2013.206

Storz, G., Vogel, J. și Wassarman, K. M. (2011). Reglarea de către ARN-uri mici în bacterii: frontiere în expansiune. Mol. Celula 43, 880 și # x02013891. doi: 10.1016 / j.molcel.2011.08.022

St & # x000FClke, J. (2002). Controlul terminării transcripției în bacterii de către proteinele care leagă ARN-ul care modulează structurile ARN. Arc. Microbiol. 177, 433 și # x02013440. doi: 10.1007 / s00203-002-0407-5

Subramanian, A. R. (1983). Structura și funcțiile proteinei ribozomale S1. Prog. Acid nucleic Res. Mol. Biol. 28, 101 și # x02013142. doi: 10.1016 / S0079-6603 (08) 60085-9

Suzuki, K., Babitzke, P., Kushner, S. R. și Romeo, T. (2006). Identificarea unei proteine ​​de reglementare noi (CsrD) care vizează ARN-urile de reglementare globale CsrB și CsrC pentru degradarea de către RNase E. Gene Dev. 20, 2605 și # x020132617. doi: 10.1101 / gad.1461606

Tortosa, P., Lindner, C., Saier, M. H., Reizer, J. și Le Coq, D. (1997). Fosforilarea multiplă a SacY, a Bacillus subtilis antiterminator transcripțional controlat negativ de sistemul fosfotransferazei. J. Biol. Chem. 272, 17230 și # x0201317237. doi: 10.1074 / jbc.272.27.17230

Tsai, B. P., Wang, X., Huang, L. și Waterman, M. L. (2011). Profilarea cantitativă a complexelor ARN-proteine ​​asamblate in vivo utilizând o nouă abordare proteomică integrată. Mol. Proteomica celulară 10, M110.007385. doi: 10.1074 / mcp.M110.007385

Tsui, H. C., Leung, H. C. și Winkler, M. E. (1994). Caracterizarea în general a fenotipurilor pleiotropice cauzate de o mutație de inserție hfq în Escherichia coli K & # x0201312. Mol. Microbiol. 13, 35 și # x0201349. doi: 10.1111 / j.1365-2958.1994.tb00400.x

Vecerek, B., Moll, I. și Bl & # x000E4si, U. (2005). Autocontrol translațional al Escherichia coli hfq ARN genă chaperonă. ARN 11, 976 și # x02013984. doi: 10.1261 / rna.2360205

Vercruysse, M., K & # x000F6hrer, C., Davies, B. W., Arnold, M. F. F., Mekalanos, J. J., RajBhandary, U. L., și colab. (2014). RNaza YbeY bacteriană extrem de conservată este esențială în vibrio cholerae, jucând un rol critic în virulență, reglarea stresului și procesarea ARN. PLoS Pathog. 10: e1004175. doi: 10.1371 / journal.ppat.1004175

Vogel, J. și Luisi, B. F. (2011). Hfq și constelația sa de ARN. Nat. Pr. Microbiol. 9, 578 și # x02013589. doi: 10.1038 / nrmicro2615

Vytvytska, O., Moll, I., Kaberdin, V. R., Von Gabain, A. și Bl & # x000E4si, U. (2000). legarea Hfq (HF1) stimulează degradarea mARN-ului ompA prin interferența cu legarea ribozomilor. Gene Dev. 14, 1109 și # x020131118. doi: 10.1101 / gad.14.9.1109

Wang, M.-C., Chien, H.-F., Tsai, Y.-L., Liu, M.-C. și Liaw, S.-J. (2014). ARN chaperona Hfq este implicată în toleranța la stres și virulența în uropatogen Proteus mirabilis. Plus unu 9: e85626. doi: 10.1371 / journal.pone.0085626

Wang, X., Dubey, A. K., Suzuki, K., Baker, C. S., Babitzke, P. și Romeo, T. (2005). CsrA reprimă post-transcripțional pgaABCD, responsabil pentru sinteza unei adezine polizaharidice a biofilmului Escherichia coli. Mol. Microbiol. 56, 1648 și # x020131663. doi: 10.1111 / j.1365-2958.2005.04648.x

Weilbacher, T., Suzuki, K., Dubey, A. K., Wang, X., Gudapaty, S., Morozov, I., și colab. (2003). O nouă componentă ARNm a sistemului de reglementare a stocării carbonului Escherichia coli. Mol. Microbiol. 48, 657 și # x02013670. doi: 10.1046 / j.1365-2958.2003.03459.x

Windbichler, N., von Pelchrzim, F., Mayer, O., Csaszar, E. și Schroeder, R. (2008). Izolarea proteinelor mici care leagă ARN de la E. coli: dovezi pentru interacțiunea frecventă a ARN-urilor cu ARN polimeraza. ARN Biol. 5, 30 și # x0201340. doi: 10.4161 / rna.5.1.5694

Yakhnin, A. V, Baker, C. S., Vakulskas, C. A., Yakhnin, H., Berezin, I., Romeo, T., și colab. (2014). CsrA activează expresia flhDC prin protejarea ARNm flhDC de scindarea mediată de RNase E. Mol. Celula 87, 851 și # x02013866. doi: 10.1111 / mmi.12136.CsrA

Yakhnin, H., Baker, C. S., Berezin, I., Evangelista, M. A., Rassin, A., Romeo, T., și colab. (2011a). CsrA reprimă traducerea sdiA, care codifică receptorul N-acilhomoserină-L-lactonă al Escherichia coli, prin legarea exclusivă în regiunea de codificare a ARNm sdiA. J. Bacteriol. 193, 6162 și # x020136170. doi: 10.1128 / JB.05975-11

Yakhnin, H., Yakhnin, A. V., Baker, C. S., Sineva, E., Berezin, I., Romeo, T., și colab. (2011b). Reglarea complexă a genei de reglare globală csrA: reprimarea translațională mediată de CsrA, transcrierea de la cinci promotori de către Esigma70 și EsigmaS și activarea transcripțională indirectă de către CsrA. Mol. Microbiol. 81, 689 și # x02013704. doi: 10.1111 / j.1365-2958.2011.07723.x

Yakhnin, H., Zhang, H., Yakhnin, A. V. și Babitzke, P. (2004). Proteina de atenuare care leagă ARN-ul de Bacillus subtilis reglează traducerea genei de transport triptofan trpP (yhaG) prin blocarea legării ribozomilor. J. Bacteriol. 186, 278 și # x02013286. doi: 10.1128 / JB.186.2.278

Yang, M., de Saizieu, A., van Loon, A. P. și Gollnick, P. (1995). Traducere trpG în Bacillus subtilis este reglat de proteina de atenuare care leagă ARN-ul trp (TRAP). J. Bacteriol. 177, 4272 și # x020134278.

Zha, D., Xu, L., Zhang, H. și Yan, Y. (2014). Sistemul GacS-GacA cu două componente activează traducerea lipA de RsmE, dar nu RsmA in Pseudomonas protejează Pf-5. Aplic. Mediu Microbiol. 80, 6627 și # x020136637. doi: 10.1128 / AEM.02184-14

Zhang, A., Wassarman, K. M., Ortega, J., Steven, A. C. și Storz, G. (2002). Proteina Hfq asemănătoare Sm crește interacțiunea OxyS ARN cu ARNm țintă. Mol. Celula 9, 11 și # x0201322. doi: 10.1016 / S1097-2765 (01) 00437-3

Cuvinte cheie: reglare post-transcripțională, proteine ​​care leagă ARN, bacterii, mecanisme de lucru, aplicații biotehnologice, reglarea traducerii, reglarea stabilității

Citare: Van Assche E, Van Puyvelde S, Vanderleyden J și Steenackers HP (2015) Proteine ​​de legare a ARN implicate în reglarea post-transcripțională a bacteriilor. Față. Microbiol. 6: 141. doi: 10.3389 / fmicb.2015.00141

Primit: 24 decembrie 2014 Lucrare în așteptare publicată: 24 ianuarie 2015
Acceptat: 06 februarie 2015 Publicat online: 03 martie 2015.

Martin G. Klotz, Universitatea din Carolina de Nord din Charlotte, SUA

Brian Stevenson, Universitatea din Kentucky, SUA
Paul Babitzke, Universitatea Penn State, SUA

Copyright & # x000A9 2015 Van Assche, Van Puyvelde, Vanderleyden și Steenackers. Acesta este un articol cu ​​acces liber distribuit în conformitate cu condițiile Creative Commons Attribution License (CC BY). Utilizarea, distribuirea sau reproducerea în alte forumuri este permisă, cu condiția ca autorul (autorii) original (i) sau licențiatul (e) să fie creditați și dacă publicația originală din acest jurnal este citată, în conformitate cu practica academică acceptată. Nu este permisă nicio utilizare, distribuție sau reproducere care nu respectă acești termeni.


Priveste filmarea: InfoPlus - Biologia 4 - Genetyka molekularna - Przebieg Replikacji (Ianuarie 2022).