Informație

Problemă cu alăturarea genei de interes în plasmida deschisă atunci când lungimile lor nu sunt aceleași


Înainte ca plasmida recombinantă să fie obținută în ADN recombinant, gena de interes este inserată într-o plasmidă liniarizată de ADN ligază.

Ce se întâmplă dacă lungimea genei de interes nu este aceeași cu cea a decalajului din plasmida deschisă? (de ex. mult mai mult) Gena poate fi în continuare conectată cu decalajul sau sunt necesare alte procese înainte ca plasmida recombinantă să poată fi readusă în bacterie?


Din întrebarea dvs., bănuiesc că vă gândiți la ADN ca fiind o moleculă foarte rigidă - nu este.

ADN-ul dublu catenar este rezonabil de flexibil și un model mental util ar fi să ne gândim la acest lucru ca la legarea capetelor a două bucăți de sârmă subțire pentru a forma un cerc.

ADN-ul dublu catenar poate face un cerc închis mai mic de 250 bp lungime1,2 și nu cred că există nicio limită superioară cunoscută - de exemplu, există un cromozom circular bacterian cunoscut în lungime de 14.782.125 bp3.

O plasmidă tipică poate găzdui inserții de orice dimensiune până la dimensiunea totală de aproximativ 50 kb, dar plasmidele care depășesc 20 kb sunt foarte greu de lucrat și pot necesita tehnici speciale de transformare.

Referințe:

1: Thibault, Thomas și colab. "Producția de ADN minicercle mai puțin de 250 de perechi de baze printr-o nouă analiză concentrată de circularizare ADN care permite proiectarea minicercurilor cu activitate de inhibare a NF-κB." Cercetarea acizilor nucleici vol. 45,5 (2017): e26. doi: 10.1093 / nar / gkw1034

2: Shore, David, Jorg Langowski și Robert L. Baldwin. "Flexibilitatea ADN-ului studiată prin închiderea covalentă a fragmentelor scurte în cercuri." Proceedings of the National Academy of Sciences 78.8 (1981): 4833-4837

3: Land, Miriam și colab. "Perspective de la 20 de ani de secvențiere a genomului bacterian." Genomică funcțională și integrativă vol. 15,2 (2015): 141-61. doi: 10.1007 / s10142-015-0433-4


Transformarea plasmidei este un mecanism prin care putem introduce gene de interes în celulele bacteriene. Pentru a face acest lucru, izolăm o altă plasmidă, introducem gena dorită și apoi punem plasmida înapoi în celulele bacteriene.

Putem izola plasmida prin diferite mijloace biochimice, iar plasmidele sunt suficient de mici încât să le putem izola întreg plasmide. (Avem dificultăți în izolarea unor bucăți întregi de ADN mai lung, care tinde să se rupă în fragmente.) Odată ce am izolat plasmida, putem aplica enzime de restricție (cum ar fi EcoRI) pentru secvențele specifice pe care le dorim plasmidei și genei. de interes. Enzimele de restricție scindează plasmida și gena noastră la locurile tăiate adesea, aceasta lasă capete de baston (capete de ADN cu o catenă monocatenară între două și patru baze). Aceste capete lipicioase se leagă ușor înapoi împreună cu alte bucăți de ADN potrivite în acest mod, putem să alăturăm gena de interes în plasmida noastră sau să tăiem alte bucăți din plasmidă. După adăugarea enzimei de restricție, adăugăm ADN ligază pentru a lega plasmida înapoi împreună (pentru a reforma legăturile covalente care țin ADN-ul împreună).

Odată ce avem plasmida ligată, am dori să o introducem în celulele bacteriene. Unele bacterii sunt în mod natural competente și vor accepta pur și simplu plasmide din mediul lor. Cu toate acestea, multe alte bacterii (cum ar fi E coli), nu sunt competenți în mod natural și trebuie să le inducem competența pentru a-i determina să accepte plasmida. Există metode electrice pentru a induce competența, care aplică un câmp și, în esență, rup bacteriile deschise pentru a accepta plasmida, deși majoritatea bacteriilor mor, unele supraviețuiesc și formează colonii. Există, de asemenea, metode chimice pentru a induce competența, cum ar fi adăugarea de clorură de calciu E coli, dar mecanismul lor de acțiune este mai complicat.

În cele din urmă, odată ce ne-am introdus plasmida în celulele bacteriene, le putem dezvolta în colonii. Dacă este nevoie, putem aplica selecția pentru plasmide recombinante, care este discutată mai târziu în această grundă tehnică.


Opțiuni de acces

Obțineți acces complet la jurnal timp de 1 an

Toate prețurile sunt prețuri NET.
TVA va fi adăugat mai târziu în casă.
Calculul impozitului va fi finalizat în timpul plății.

Obțineți acces limitat la timp sau la articol complet pe ReadCube.

Toate prețurile sunt prețuri NET.


Metode care necesită recombinare ADN în celule de mamifere

Metoda clasică de a genera vectori de adenovirus substituiți cu E1 necesită recombinarea între două molecule de ADN, una care poartă secvențe cartografiate până la capătul stâng al genomului adenovirusului și gena de interes, iar cealaltă care poartă secvențe care se suprapun ușor pe cel mai viral 3 ′ secvențe pe prima moleculă și continuă până la capătul drept al genomului adenovirusului. Acesta din urmă, pe care îl vom numi drept secvențe de capăt dreapta pentru simplitate, poate fi fie un ADN liniar purificat de virioni, fie o plasmidă. Această recombinare are loc în interiorul celulelor care exprimă E1, cum ar fi 293 celule, generând ADN-ul viral recombinant dorit.

Inițial, capătul drept al genomului adenovirusului a fost obținut prin digestia ADN-ului viral cu o enzimă (restricții) de restricție care taie în regiunea E1 (Figura 2a). este dificil să se verifice completitudinea digestului prin electroforeză pe gel de agaroză sau să se separe cele două ADN-uri pentru purificare. Aceasta poate fi o problemă, deoarece ADN-ul viral nedigerat va genera virusul mai eficient decât produsul de recombinare, ducând la contaminarea preparatului de virus recombinant cu virusul parental. Mai mult, fragmentele de restricție mici care corespund capătului stâng al genomului și care sunt transportate în timpul transfecției se pot relata în interiorul celulei și pot genera un adenovirus competent pentru replicare.4344 Prin urmare, trebuie efectuate două sau trei runde de purificare prin testarea plăcii și trebuie analizate mai multe plăci pentru a identifica virusul recombinant. Un al doilea dezavantaj al acestei metode este că evenimentul de recombinare, care este necesar pentru a lega secvențele de adenovirus stâng care poartă gena de interes cu secvențele de capăt dreapta, este ineficient în celulele de mamifere. Prin urmare, durează de obicei până la 2 săptămâni până când virusul recombinant apare.

(a) Construcția vectorilor de adenovirus substituiți cu E1 prin recombinare clasică în celule ajutătoare. Consultați textul pentru explicații și legenda din Figura 1 pentru definițiile simbolurilor. Săgeata dublă reprezintă caseta de expresie. Virușii goi și negri din partea de jos a panoului indică viruși parentali și, respectiv, recombinați. (b) Construcția vectorilor de adenovirus substituiți cu E1 din ADN-uri circulare infecțioase de adenovirus. Ori, Amp: colE1 originea replicării și respectiv a genei de rezistență la ampicilină. Tabelele sintetizează principalele caracteristici ale ambelor tehnici și ale derivatelor acestora. În fiecare tabel, caracteristicile menționate de mai multe ori sunt menționate prin numere între paranteze.

Au fost dezvoltate trei metode pentru a facilita detectarea și purificarea virusului recombinant. Prin utilizarea unui ADN viral în care regiunea E1 este înlocuită cu o casetă care exprimă timidin kinaza HSV (tk), 45, contraselecția împotriva virusului de fond parental poate fi efectuată prin adăugarea de ganciclovir la suprafata de agar. Această contraselecție este fiabilă doar pe un test de placă secundară, totuși, deoarece plăcile primare obținute direct după transfecție pot proveni din celule care au preluat mai mulți genomi virali și conțin atât tk-exprimarea virusului parental și a virusului recombinant. În mod similar, ADN-ul viral în care regiunea E1 este înlocuită cu o casetă care exprimă E coli β-galactozidaza43 sau o proteină fluorescentă verde46 pot fi utilizate ca ADN parental. Plăcile care conțin virusul de fond sunt detectate fie prin colorare cu X-gal, fie prin microscopie cu fluorescență, respectiv. Aceste două metode permit izolarea virusului recombinant în timpul primei runde de purificare. Ar fi totuși mai precaut și o procedură virologică adecvată să se efectueze o a doua rundă de purificare a plăcii, așa cum este sugerat pentru tk-exprimarea virusului.

Complexul ADenovirus ADN-proteină terminală poate genera plăci virale cu o eficiență de două până la trei ordine de mărime mai mare decât ADN-ul gol preparat cu proteinază. Timp de decenii, astfel de complexe au fost folosite pentru a construi adenovirusuri recombinante.47484950 Mai recent, a fost adaptată o tehnică în care complexul proteinei ADN-terminal este digerat cu o enzimă de restricție în mai multe situri din genomul Ad5, prevenind mai bine regenerarea virus parental.51 Caseta de expresie este clonată într-un cosmid care conține o copie completă a genomului adenovirusului. Atât cosmidul circular, cât și ADN-ul viral digerat sunt transfectate în celule ajutătoare. Câteva sute de plăci, care apar prin recombinarea genomului derivat din cosmide de lungime completă cu cele două capete terminale ale genomului legate de proteine, sunt obținute de obicei folosind această procedură, dintre care aproximativ 70% sunt pozitive pentru prezența casetei de expresie.

Pentru a depăși ineficiența recombinării omoloage în celulele de mamifere, a fost dezvoltată o tehnică care utilizează bacteriofagul P1 Cre-lox sistemul de recombinare.52 Acest sistem este compus din trei elemente: (1) un adenovirus recombinant care conține două loxP site-uri care flancează semnalul de ambalare (2) un vector de navetă care conține ITR stânga, semnalul de ambalare, caseta de expresie și o loxP site (3) o linie celulară derivată din 293 care exprimă fagul P1 Cre recombinază. Pentru a genera vectori adenovirus substituiți cu E1, vectorul navetă care poartă gena de interes și ADN-ul viral sunt co-transfectate în celulele ajutătoare. În primul rând, are loc o recombinare intramoleculară între cele două loxP site-uri prezente în ADN-ul viral. Acest lucru generează un genom adenovirus care este capabil să reproducă și să exprime genele virale, dar nu poate fi ambalat. O a doua recombinare are loc între loxP site-ul acestui produs și cel de pe vectorul navetă, generând virusul recombinant dorit. Principalul dezavantaj al acestei metode este persistența virusului parental în preparat, care poate reprezenta până la 30% din populația virală după primul pasaj și constituie în continuare 0,2% după trei pasaje. Prin urmare, această metodă necesită o verificare atentă a identității virusului recombinant.

O îmbunătățire foarte recentă a acestei tehnici a fost obținută folosind ADN-ul adenovirusului izolat din plasmide în loc de particule virale. Această plasmidă, linearizată la un sit care flancează ITR-ul drept, este co-transfectată în celule ajutătoare cu o plasmidă navetă care conține secvențele de adenovirus stâng și caseta de expresie. Virusul este generat la recombinarea omologă a ADN-ului între ambele molecule de ADN. Spre deosebire de metodele descrise mai sus, contaminarea cu virusul parental nu este posibilă și, prin urmare, trebuie analizat un număr limitat de plăci.

O altă abordare pentru a construi vectori adenovirus recombinați se bazează pe capacitatea ADN-urilor circulare de adenovirus de a genera virusul la transfecția în 293 celule (Figura 2b). și, prin urmare, sunt capabili să se replice în E coli ca plasmide. Acești vectori au fost ulterior modificați pentru a-și mări dimensiunea la aproximativ 40 kb sau au fost șterse pentru semnalul de ambalare. Aceste caracteristici fac ca moleculele parentale să nu poată fi ambalate în virioni și, prin urmare, ar trebui să se poată obține un preparat omogen de virus recombinant. În acest sistem, gena de interes este clonată într-o plasmidă mică care conține capătul stâng al genomului adenovirusului. Plasmida rezultată, linearizată, este co-transfectată în celule ajutătoare cu plasmida circulară de adenovirus. Recombinarea trebuie să aibă loc între ambii ADN-uri pentru a crea o moleculă care poate fi replicată și ambalată pentru a genera virusul recombinant. Aceeași tehnică poate fi utilizată pentru a insera casete de expresie în regiunea E3 sau în ambele regiuni E1 și E3. Cu toate acestea, manipularea acestor plasmide mari în E coli este dificilă datorită prezenței unei secvențe palindromice lungi de 200 bp care rezultă din juxtapunerea ITR-urilor adenovirusului stâng și drept în construcția plasmidei. Se știe că astfel de structuri sunt instabile E coli și dăunătoare pentru creșterea bacteriană.55 Mai mult, formarea plăcilor la transfecția ADN-ului circular de adenovirus a fost raportată a fi ineficientă, 41 probabil deoarece ITR-urile adenovirusului încorporat inițiază sinteza ADN mai puțin eficient decât cele de la capetele ADN-ului liniar.56 A 293 celule linia care exprimă în mod constitutiv proteina preterminală a adenovirusului și ADN polimeraza poate fi utilizată pentru a depăși această problemă de replicare.41

În ceea ce privește tehnicile care utilizează ADN-uri virale liniare, această metodă omologă de recombinare a fost îmbunătățită folosind Cre-lox sistem de recombinare. Într-o primă întruchipare, loxSite-urile P au fost inserate atât în ​​ADN-ul circular mare de adenovirus, cât și în plasmida mică navetă.57 Adenovirusul recombinant este obținut ca urmare a recombinării mediate de Cre între ambele plasmide după cotransfecția lor într-o linie celulară 293 care exprimă recombinaza Cre. Frecvența salvării virusurilor folosind acest sistem specific de recombinare este semnificativ mai mare (de aproximativ 30 de ori) decât cu in vivo recombinare omoloagă. Într-un al doilea exemplu de realizare, regiunea E1 a formei circulare a ADN-ului adenovirusului este înlocuită cu un vector cosmid flancat de loxP situri.58 Ca mai sus, această înlocuire produce o moleculă de ADN prea mare pentru a fi ambalată în virioni. Casetele de expresie sunt inserate între loxP- coloana vertebrală cosmidă flancată și genomul adenovirusului prin ambalare în fagul λ. Cosmida rezultată este transfectată în celule ajutătoare care exprimă recombinaza Cre. O cre- intramolecularălox recombinarea mediată excizează coloana vertebrală a vectorului cosmid și produce o moleculă care poate fi ambalată în virioni. Folosind această metodă, plăcile virale sunt observate între 8 și 10 zile după transfecție.


Rezultate

Inactivarea eficientă a genei pigmentare olvA în A. niger prin sistemul CRISPR / Cas9 încorporat elementul HH-sgRNA-HDV

Pentru a testa fezabilitatea și eficiența sistemului CRISPR / Cas9 în A. niger, alegem să vizăm olvA genă care poate fi ușor testată fenotipic după inactivare. olvA gena codifică omologul YWA1 hidrolazei și ștergerea sa poate forma conidii de măsline pe mediul de regenerare, în timp ce tulpina sălbatică prezintă conidii negre. Un 20 pb din secvența protospacer cu 3'-PAM AGG pentru olvA a fost ales la începutul ORF (nucleotidă - 18 până la - 37). Plasmidele rezultate pAN1 au fost transformate în A. niger prin transformarea protoplastului. Majoritatea transformanților (24/26) crescuți pe plăci de higromicină (Fig. 4a) au prezentat fenotipul dorit al coloniilor de măsline, cu o rată mutațională de peste 90%. Deoarece conidia de A. niger conțin două sau mai multe nuclee, este necesară izolarea unei singure colonii mutante de transformanții originali. Am diluat conidia transformanților primari la 10 4-10 ori de 5 ori și am dovedit diluantul conidiei pe mediu cu higromicină pentru o creștere de 3 zile pentru a izola homozigotii (Fig. 4b). Ulterior, ADN-ul genomului extras din colonia unică pozitivă a fost folosit ca șablon pentru identificarea PCR și ADN. Rezultatele secvențierii au reflectat fie ștergerea unui singur nucleotid, fie mutația în amonte de motivul PAM din olvA genă în cei doi transformanți (Tabelul 2).

Primară și a doua generație de transformanți în care olvA a fost inactivat de sistemul CRISPR / Cas9. A Creșterea tulpinii de tip sălbatic (WT) și a mutanților ΔolvA. b Creșterea unei singure colonii sa propagat din transformanții primari

Expresie excesivă a glaA și reducerea reglementării agdF într-un singur pas de CRISPR

După transformarea prin plasmida pAN-agdF și repară fragmentul care conține glaA casetă de expresie și brațe de 1 kb omoloage agdF, A. niger s-au obținut colonii cu rezistență la higromicină. A fost efectuată verificarea PCR a părților în sus și în jos a inserției (Fig. 3b) în genomul transformanților pozitivi. Rezultatul arată (Fig. 3c) trei din cinci candidați care posedă fragmentul de inserție. Unul dintre cei trei a fost selectat ca agdF :: glaA mutant pentru analiza ulterioară a activității enzimatice. După cum se arată în Fig. 5, activitatea glucoamilazei de agdF :: glaA mutant a fost cu 25,9% mai mare decât tulpina sălbatică, în timp ce activitatea α-glucozidazei de agdF :: glaA mutantul a fost cu 61,4% mai mic decât tulpina sălbatică.

Comparația activității enzimei între tulpina sălbatică și mutantul agdF :: glaA. A Comparația activității glucoamilazei. b Comparația activității α-glucozidazei (n = 5, *p & lt 0,05)

Eficiența înlocuirii genelor cu lungimea diferită a brațului omolog

Pentru a testa relația dintre eficiența înlocuirii genelor și lungimea brațelor omoloage, am proiectat în continuare fragmentele de reparare cu 2 seturi de lungimi diferite ale brațelor (500 și 100 bp) pe baza experimentului menționat mai sus. Am co-transformat plasmida PAN-agdF și fragmentele de reparare cu lungime diferită a brațelor omoloage. După co-transformare, am selectat 3 sau 5 transformanți din fiecare transformare și le-am extras ADN-ul genomului pentru identificarea PCR. Și am constatat că toți transformanții testați (3/3 și respectiv 5/5) au fost pozitivi. Rezultatele PCR (Fig. 6) au demonstrat că o pereche de brațe de omologie 100-bp este suficientă pentru a obține integrarea omologă stimulată de sistemul CRISPR / Cas9 în A. niger cu randament ridicat.

Verificarea genotipului prin PCR în transformanții selectați după co-transformarea fragmentelor de reparare cu lungimi diferite ale brațelor omoloage. Lungimea așteptată pentru produsul amplificat de la mutanții agdF :: glaA a fost de aproximativ 820 bp atât pentru PCR în sus cât și în aval, în timp ce nu va fi produsă nicio bandă din tulpina de tip larg CBS513.88. A Rezultatele PCR utilizând un braț omolog de 500 bp. Rezultatele au arătat că toți cei 3 candidați testați aveau genotipul așteptat. b Rezultatele PCR utilizând un braț omolog de 100 bp. Rezultatele au arătat că toți cei 5 candidați testați aveau genotipul așteptat


MATERIALE ȘI METODE

Cultură de celule

Celulele rinichiului embrionar uman (HEK293) (Invitrogen) au fost cultivate în DMEM suplimentat cu 10% ser fetal de vițel (FCS). Celulele HEK293 au exprimat constitutiv gena E1 ștearsă Adeasy in-trans. Particulele de virus infecțios au fost produse după ce aceste celule au fost transfectate cu vectori de adenovirus șterse E1. După infecția cu adenovirusurile recombinante, celulele au fost menținute în DMEM suplimentat cu 5% FCS.

Bacterii, plasmide și ADN viral

E coli tulpinile DH10β și BUN21 și plasmida pML300 au fost donate cu amabilitate de către Prof. Stephen J Elledge de la Harvard Medical School din Boston, (MA, SUA) (18). DH10β a fost utilizat pentru generarea plasmidei donatoare recombinante și BUN21 a fost utilizat pentru generarea și propagarea plasmidelor adenovirale recombinante. Plasmida pML300 conținută în BUN21 poartă gena roșie și gam recombinază indusă de ramnoză și nu poate să se replice atunci când bacteriile cresc la 42 ° C (18). Plasmida MAGIC1 și plasmida 1202 au fost, de asemenea, furnizate de Prof. Stephen J Elledge (18). Vectorul osos adenovirus (pAdeasy) și plasmida pShuttle au fost obținute de la Stratagene (15). Am construit noul plasmid donator pRTRA (Figura 1), plasmida receptor pAd-pheS (genomul adenoviral de lungime completă), plasmida pPic-man și plasmida pShuttle-cmv-red-sv40polA.

Clonarea genelor străine gfp și om în plasmida donatoare utilizând enzima de restricție Bsu36I și ADN polimeraza T4

The gfp gena a fost amplificată din pEGFP-1 (Clontech) prin PCR. Grundul înainte a fost 5'- TTAC GATGGTGAGCAAGGGCGAGGA-3 ', iar grundul invers a fost 5'- TGAC TTACTTGTACAGCTCGTCCATGCC-3'. The om gena a fost amplificată de la pPic-man folosind primerii: ZL15F, 5'- TTACT GAAGCGCATACTGTGTCGCC-3 'și ZL16R, 5'- TGAC CGGATTCACTCAACGATTGG-3'. Fragmentele amplificate au fost incubate cu 0,5 U de ADN polimerază T4 și 4 mM dGTP (TaKaRa) la 12 ° C timp de 45 de minute, așa cum s-a descris anterior (19, 20). Pentru fiecare genă, un total de 30 ng de fragmente tratate și 1 ng de pSRTRA digerată cu Bsu36I (CCTTAGG și CCTGAGG) au fost ligate cu 5 U de ADN ligază ™ T4 (TaKaRa) la 16 ° C timp de 12 ore în 1 μl tampon . The gfp genă și om gena au fost inserate în pRTRA pentru a forma plasmidele pRTGA și pRTMA separat (Figura 2).

Modificarea plasmidei donatoare

Fragmentul de genă rezistentă la cloramfenicol a fost amplificat din pBT (Strategene) prin PCR utilizând primerul înainte [5'-TTT GTCGACATAACTTCGTATAATGTATGCTATACGAAGTTAT ACGGGGAGAGCCTGAGCAAAC (SalI și 34 bp loxP site subliniat)] și primerul invers [5′-TTTGCATGCTG (ApaLI, site-uri loxP de 34 bp subliniate)]. PCR s-a efectuat la 95 ° C timp de 5 min, urmat de 25 de cicluri la 95 ° C timp de 45 s, 56 ° C timp de 45 s și 72 ° C timp de 1 min folosind Thermo Hybrid PX2 (Thermo) și TaKaRa Extaq ™ polimerază (TaKaRa). Fragmentul tăiat de ApaLI și SalI a fost ligat în vectorul pRTRA (de asemenea tăiat de aceleași enzime), rezultând plasmida recombinantă pRTRC.

Generarea vectorului adenoviral recombinant de către MAGIC

Strategia generală dezvoltată este prezentată în Figura 3. E coli DH10β conținând vectorul donator pRTRA a fost crescut în bulion Luria – Bertani (LB) conținând ampicilină (100 μg / ml). Tulpina primitoare BUN21 conținând plasmida pML300 și plasmida primitoare pAd-pheS a fost crescută în bulion LB conținând spectinomicină (50 μg / ml), kanamicină (50 μg / ml) și glucoză (0,2% g / v) peste noapte. Tulpina destinatarului a fost spălată de două ori cu 2 volume de bulion LB a doua zi. Tulpinile donator și primitor au fost diluate separat la 1:25, 1:50, 1: 100 sau 1: 200 cu bulion LB conținând ramnoză 0,2% g / v și crescute la 30 ° C timp de 2 ore până la A 600 de 0,15-0,25, iar tulpinile donator și primitor au fost amestecate la un raport de 1: 1 pe baza A lor 600 în prezența a 0,2% g / v l -arabinoză. Amestecul a fost incubat la 37 ° C timp de 2 ore fără agitare, apoi pentru încă 2 ore cu agitare. Cultura recombinantă a fost diluată la un raport de 1: 100, plasată pe plăcile selective care conțin kanamicină (50 μg / ml), ampicilină (100 μg / ml), 10 mM Cl-Phe și 0,2% g / vl-arabinoză și incubat în cele din urmă la 42 ° C peste noapte (18).

Producerea adenovirusurilor recombinante și proliferarea

Plasmidele adenovirale recombinate au fost amplificate prin incubarea coloniei identificate în 50 ml bulion LB conținând kanamicină (50 μg / ml), ampicilină (100 μg / ml) și 0,2% greutate / volum arabinoză. Cultura a fost crescută peste noapte la 37 ° C. ADN-ul maxiprep a fost apoi preparat din cultura lichidă și digerat într-o cantitate suficientă (5 μg de ADN) cu PacI. Ulterior, tamponul și excesul de enzimă din reacțiile de restricție au fost îndepărtate prin extracția fenolului / precipitarea etanolului. ADN-ul a fost resuspendat în 50 pl de tampon steril 0,1 × TE sau dH 2 O, și apoi adăugat la celulele HEK293 în prezența Lipofectaminei 2000 (Invitrogen). La 4 h post-transfecție, celulele au fost incubate în 5 ml DMEM conținând 5% FCS. La aproximativ 8 zile după transfecție, celulele au fost recoltate și peletizate prin centrifugare cu viteză redusă, iar virușii au fost eliberați prin trei cicluri de îngheț / dezgheț. Lizatul celular [1 ml în 1 × soluție salină tamponată cu fosfat (PBS) (pH 7,4)] conținând adenovirusurile recombinante a fost apoi amplificat și purificat. Pentru a genera stocuri virale mai mari, celulele HEK 293 au fost infectate de lizatul celular și procesul de recoltare a fost repetat.

Construirea unui model de bibliotecă de expresie ADNc adenoviral

Tulpina donatoare care conține pRTRA și tulpina donatoare care conține pRTGA au fost amestecate la rapoarte de 1:30, 1: 300, 1: 3000 și 1:30 000 pe baza A lor 600 . Petele de donator mixte la diferite rapoarte au fost amestecate cu tulpina primitoare la un raport de 1: 1 pe baza A lor 600 (3, 18). Experimentele ulterioare s-au bazat pe procedura MAGIC completă, după cum sa raportat anterior (18). Bulionul LB a fost utilizat pentru a spăla toate coloniile de pe plăcile selective care au fost apoi incubate peste noapte în 100 ml bulion LB conținând 50 μg / ml kanamicină, 100 μg / ml ampicilină, 0,2% greutate / l l-arabinoză și 10 mM Cl-Phe. ADN-ul a fost extras pentru randamente mai mari, tratat cu PacI, iar tamponul în exces și enzima au fost îndepărtate prin extracția fenolului / precipitarea etanolului. ADN-ul (5 μg) a fost resuspendat în 100 μl de tampon steril 0,1 × TE sau dH 2 O, și apoi adăugat la o placă de 60 mm conținând 1 × 106 celule HEK293 care fuseseră incubate în DMEM cu 5% FCS timp de 2 ore. La 4 h post-transfecție, celulele au fost incubate timp de 8 zile în 5 ml DMEM conținând 5% FCS. După trei cicluri de îngheț-dezgheț, lizatul rezultat (1 ml) a fost utilizat pentru a infecta celulele HEK 293 într-o placă de 10 cm (70% confluent) timp de 1 oră înainte de a fi incubat cu 5 ml DMEM suplimentat cu 5% FCS.


Logica elementelor genetice egoiste

Deși elementele genetice egoiste arată o diversitate remarcabilă în modul în care își promovează propria transmisie, se pot face unele generalizări despre biologia lor. Într-o recenzie clasică din 2001, Gregory D.D. Hurst și John H. Werren au propus două & # x02018reguli & # x02019 de elemente genetice egoiste. [4]

Regula 1: Răspândirea elementelor genetice egoiste necesită sex și extragere

Reproducerea sexuală implică amestecarea genelor de la doi indivizi. Conform Legii Segregării Mendel & # x02019s, alelele dintr-un organism cu reproducere sexuală au șanse de 50% de a fi transmise de la părinte la descendenți. Prin urmare, meioza este uneori denumită & # x0201cfair & # x0201d. [30]

Genomurile extrem de auto-fertilizante sau asexuate se așteaptă să aibă mai puține conflicte între elementele genetice egoiste și restul genomului gazdă decât depășirea genomurilor sexuale. [31 & # x0201333] Există mai multe motive pentru aceasta. În primul rând, sexul și încrucișarea au pus elemente genetice egoiste în noi linii genetice. În contrast, într-o descendență extrem de egoistă sau asexuată, orice element genetic egoist este în esență blocat în acea descendență, ceea ce ar trebui să crească variația fitnessului între indivizi. Variația crescută ar trebui să aibă ca rezultat o selecție purificatoare mai puternică în selfers / asexuali, întrucât o filiație fără elemente genetice egoiste ar trebui să concureze o filiație cu elementul genetic egoist. În al doilea rând, creșterea homozigozității în selfers elimină oportunitatea concurenței între alelele omoloage. În al treilea rând, lucrările teoretice au arătat că dezechilibrul de legătură mai mare în autoingresiune comparativ cu genomul excesiv poate, în unele cazuri, deși destul de limitat, să determine selecția pentru rate de transpunere reduse. [34] În general, acest raționament conduce la prezicerea că asexuații / selfers ar trebui să experimenteze o sarcină mai mică de elemente genetice egoiste. Un avertisment la acest lucru este că evoluția autoingresării este asociată cu o reducere a dimensiunii efective a populației. [35] O reducere a dimensiunii efective a populației ar trebui să reducă eficacitatea selecției și, prin urmare, conduce la predicția opusă: acumularea mai mare de elemente genetice egoiste în selfers în raport cu outcrossers. Dovezile empirice pentru importanța sexului și a încrucișării provin dintr-o varietate de elemente genetice egoiste, inclusiv elemente transpozabile, [36,37] plasmide auto-promovante, [38] și cromozomi B. [39]

Regula 2: Prezența elementelor genetice egoiste este adesea dezvăluită în hibrizi

Prezența elementelor genetice egoiste poate fi dificil de detectat la populațiile naturale. În schimb, consecințele lor fenotipice devin adesea evidente la hibrizi. Primele motive pentru acest lucru este că unele elemente genetice egoiste trec rapid la fixare și, prin urmare, efectele fenotipice nu vor fi segregarea populației. Cu toate acestea, evenimentele de hibridizare vor produce descendenți cu și fără elemente genetice egoiste și vor dezvălui astfel prezența lor. Al doilea motiv este acela că genomii gazdei au dezvoltat mecanisme pentru a suprima activitatea elementelor genetice egoiste, de exemplu, micul ARN administrat de tăcere a elementelor transpozabile. [40] Co-evoluția dintre elementele genetice egoiste și supresorii acestora poate fi rapidă și urmează o dinamică a Reginei Roșii, care poate masca prezența elementelor genetice egoiste într-o populație. Puii hibrizi, pe de altă parte, pot moșteni un anumit element egoist genetic, dar nu supresorul corespunzător și astfel dezvăluie efectul fenotipic al elementului genetic egoist. [41,42]


Hartă de restricționare și rezumat virtual

Hărțile ADN sunt reprezentări simplificate ale secvențelor de nucleotide, care prezintă caracteristici de interes deosebit, cum ar fi genele. Hărțile de restricție sunt hărți ADN care prezintă site-uri de restricție, locațiile în care enzimele de restricție specifice vor tăia ADN-ul. Iată o hartă a pGLO:

Am făcut această hartă cu Benchling, pachetul software online pe care îl folosesc de obicei pentru analiza secvențelor de nucleotide. Unele dintre caracteristicile acestei hărți pGLO ar trebui să pară familiare, cum ar fi gena de rezistență la ampicilină (AmpR) și gena GFP. De asemenea, sunt incluse siturile de restricție pentru trei enzime pe care le avem în laborator: HindIII, PvuI și EcoRI. Această hartă vă va oferi o idee generală despre dimensiunea fragmentelor de ADN de așteptat dacă tăiați pGLO cu fiecare dintre aceste enzime:

  • PvuI: Taie o dată, astfel încât să obțineți o singură bucată liniară, de dimensiunea întregii plasmide (5371 pb).
  • EcoRI: Taie o dată, astfel încât să obțineți o singură bucată liniară, de dimensiunea întregii plasmide (5371 pb). Deși EcoRI taie într-un loc diferit de PvuI, fragmentul rezultat va avea aceeași dimensiune.
  • HindIII: Taie de două ori, deci veți obține o bucată mică și o bucată mare.

Acum, să presupunem că doriți să tăiați plasmida cu mai multe enzime la un moment dat. Fiecare enzimă va acționa pe propriile sale situri de restricție, astfel încât diferitele enzime nu se vor afecta reciproc. Din harta de mai sus, puteți vedea că, dacă tăiați atât cu EcoRI cât și cu HindIII, veți tăia o bucată mică între site-urile EcoRI și HindIII, probabil că nu ați putea vedea acest mic fragment pe un gel, deci nu este merită să efectuați acest rezumat. Să presupunem că tăiați împreună cu PvuI și EcoRI. Folosind această hartă puțin mai detaliată (prin amabilitatea lui Snapgene), ar trebui să puteți prevedea dimensiunile exacte ale fragmentelor de ADN pe care le veți obține:

Această hartă arată locațiile exacte ale site-urilor de restricție. Fiecărei nucleotide i se atribuie un număr, pe baza unui punct de plecare ales în mod arbitrar. Dacă PvuI taie la nucleotida 3054 și EcoRI taie la nucleotida 2063 și întreaga plasmidă circulară are 5371 bp lungime, probabil că vă puteți da seama de dimensiunile fragmentelor pe care le veți obține.

Din păcate, harta de mai sus lasă în afara site-urile HindIII (nu știu de ce nu au fost incluse).

Efectuați câteva rezumate virtuale ale pGLO

Folosind enzimele de restricție pe care le avem în laborator, cea mai bună combinație pentru a obține fragmente de pGLO bine distanțate pe gel ar fi HindIII și PvuI. Pentru a afla rezultatele așteptate ale digestului HindIII + PvuI, puteți utiliza un software de cartografiere a restricțiilor, cum ar fi acesta:

Pentru un digest electronic de restricție precis, trebuie să introduceți secvența de nucleotide a ADN-ului pe care îl veți tăia. Găsiți secvența pGLO (secvența originală de la Bio-Rad) pe pagina Date de secvență (păstrați pagina respectivă deschisă într-o altă filă, o veți folosi din nou).

Copy the whole sequence, including the numbers, and paste it into the "sequence info" box in the Restriction Analyzer (the software will ignore the numbers and spaces, and only look at the nucleotide sequence). Note that the sequence is shown for only one strand of DNA, but the software is smart enough to recognize that the actual DNA is double-stranded. Check "Circular" under Conformation, and then go to the Include box and select PvuI. Click pe Virtual Digest.

Virtual digest will take you to a page showing the complete nucleotide sequences of the DNA fragments produced in the digest (which you probably don't care about) and also the length of each fragment (which you will be able to verify on your gel. Those fragment lengths are your expected results for this experiment.

Repeat the virtual digest procedure for the enzyme SspI.

Alternative approach: You could also use Benchling instead of RestrictionMapper. Benchling is more modern and more powerful, but it takes a little while to learn and you will have to sign up for a (free) account. Personally, I use Benchling for most of my sequence work, and I recommend it.

Make your own map of pGLO

Draw your own simplified map of pGLO. Show the exact cut sites for PvuI and SspI. Also include the approximate locations of the GFP, AmpR (ampicillin resistance, also called β-lactamase or bla), and AraC genes.

Perform virtual digests of pGLO non-fluorescent mutant

The Bio 6B Special Projects students accidentally created a mutant version of pGLO that doesn't have a functional GFP gene. Find the sequence for the pGLO Non-Fluorescent Mutant on the sequence page.

Perform virtual digests of this sequence the same way you did with the original pGLO sequence. You should get a slightly different result for one of the enzymes.

On the pGLO map, show where the mutant sequence differs from the original.

Perform a virtual digest of lambda

Lambda bacteriophage is the DNA you'll use as a molecular weight marker. This DNA is widely available gets cut into a range of predictably sized fragments, making it one of the most common molecular weight markers.

Find the sequence of lambda on the Sequence Data page. The lambda genome is linear DNA, unlike the circular plasmids.

Perform a virtual digest of lambda with the enzyme Hind III and write down the fragment sizes. Unlike the plasmids, lambda DNA is linear, so check the appropriate box before doing the digest.

Diagram the gel results

Draw a labeled picture of the expected gel results for the following restriction digests:

  • pGLO Green cut with PvuI
  • pGLO Green cut with SspI
  • pGLO Non-Fluorescent cut with PvuI
  • pGLO Non-Fluorescent cut with SspI
  • Lambda DNA cut with Hind III

Draw a diagram of the gel showing the relative positions of the bands, and label each band with its size in base pairs. This will represent your expected results for the actual digest that you perform.

How much DNA per band?

If you perform a restriction digest and run it on a gel, you'd like to be able to see all the bands. Your ability to see a band on the gel depends on how many nanograms of DNA are in that band, as well as how you stain the DNA. We use ethidium bromide in our gels, which allows us to visualize individual bands containing as little as 50 ng. However, the different bands from a digest won't have the same mass of DNA. If you cut some DNA into two fragments and one fragment is twice as large as the other, the larger fragment will have twice the mass of the smaller fragment.

Suppose you are doing a restriction digest of lambda using the enzyme Hind III. If you start with 500 ng of uncut lambda DNA, how many nanograms of DNA will be in each of the bands on your gel? Label the bands in the Lambda/Hind III lane of your gel diagram with the amount in nanograms. Do you think you'll be able to see the smallest band?

What to turn in

Working with your lab partners, make one pGLO map (showing cut sites for both the unmutated and mutated versions) and one gel picture for your lab group. Label the gel diagram in terms of base pairs and (for Lambda/Hind III only) nanograms. Turn the diagrams in today in lab, with the names of everyone who worked on it. This counts as a quiz.


Gene (genome) editing to produce genetically modified animals with gene knock-out or knock-in

The initial methods used to generate transgenic livestock resulted in random transgene insertion [10] therefore, new technologies are needed to enable better gene targeting with a higher efficiency in livestock. Although it is conceptually simple to deliver DNA into a fertilized egg via pronuclei injection, this method is technically challenging and the injected DNA construct is integrated randomly into the genome, resulting in unpredictable transgene expression profiles. In addition, microinjection can damage the zygote and requires expensive equipment. These short-comings can be partly overcome by the development of gene (genome) editing approach, which uses a designer nuclease (as a pair of molecular scissors) to generate a double strand break (DSB) in DNA at a desired genomic locus (Fig. 5). Thereafter, one of two endogenous repair mechanisms may repair the DSB DNA: non-homologous end joining (NHEJ) and the homology-directed repair (HDR) [38]. In the error-prone NHEJ pathway, the two ends of the DSB DNA are brought together and ligated without a homologous template for repair, which often inserts or deletes nucleotides (indels). If an indel results in a frame shift mutation, the target gene may lose function (knockout). The HDR pathway requires the provision of an exogenous DNA template along with a site-specific genome editing nuclease to repair the DSB DNA, thereby causing the knock-in of a desired sequence of DNA into the genome of an embryo or animal cells [67]. In practice, modification of a targeted gene is commonly achieved by microinjecting, into an embryo obtained by in vitro fertilization or intracytoplasmic transfer, a gene editing system that consists of a guide RNA and the Cas9 endonuclease, and, if necessary, a repair DNA template [68]. The guide RNA provides sequence specificity to target the Cas9 endonuclease to a complementary site in the genome for creating a DSB.

Gene (genome) editing of animals using the ZFN, TALEN or CRISPR/Cas9 technique. a designer nuclease (ZFN, TALEN or CRISPR/Cas9) cleaves a DNA molecule to generate a double strand break (DSB) at a desired genomic locus. Thereafter, one of two endogenous repair mechanisms may repair the DSB DNA: non-homologous end joining (NHEJ) and the homology-directed repair (HDR). In the NHEJ pathway, the two ends of the DSB DNA are brought together and ligated without a homologous template for repair, which often inserts or deletes nucleotides (indels) to cause gene disruption (knockout). The HDR pathway requires the provision of an exogenous DNA template along with a site-specific genome editing nuclease to repair the DSB DNA, thereby causing the knock-in of a desired sequence of DNA into the genome of an embryo or animal cells. Because of its more precise targeting of genes, CRISPR/Cas9 is gaining momentum in life sciences as the preferred editor of gene editing of livestock species

An earlier designer nuclease was zinc finger nuclease (ZFN the first gene editing tool), and a subsequently discovered designer nuclease is transcription activator-like effector nuclease (TALEN, the second gene editing tool), both of which are modular proteins containing an adaptable DNA-binding domain. The ZFN method involves engineering a protein that contains both a zinc finger DNA-binding domain and a restriction endonuclease domain. The TALEN approach utilizes engineered enzymes containing a DNA-binding domain and a separate DNA-cleaving domain. In recent years, CRISPR (clustered regularly interspaced short palindromic repeats)-associated nuclease-9 (CRISPR/Cas9) has been used as a designer nuclease to provide a more efficient, more accurate, more versatile, more robust, and simpler tool in genomic engineering [19, 62]. ZFN, TALEN, or CRISPR/Cas9 components are delivered into target cells through transfection (lipid-based agents, electroporation, nucleofection, or microinjection) or bacteriophages, depending on cell type and plasmid [69,70,71].

TALENs and CRISPR/Cas9 were first successfully used in pigs in 2013 [72] and 2014 [59, 73], respectively. Over the past 5 years, CRISPR/Cas9 has rapidly gained momentum as the favored gene editor for livestock species. The CRISPR-Cas9 system was discovered in 2007 in bacteria (e.g., a genus of gram-positive cocci or spherical bacteria) and archaea, and is used naturally to defend against invading viruses (bacteriophages). In response to a viral infection, the bacterial CRISPR/Cas9 is guided by a short RNA fragment known as a guide RNA to snip off a piece of viral DNA, creating a DSB in its target loci [68]. The guide RNA is complementary to a segment of the genome of the targeted organism, so that the Cas9 nuclease will cleave DNA with a high degree of specificity. Of note, recognition of the target DNA by Cas9 is dependent on the presence of a short protospacer adjacent motif (PAM) sequence located directly downstream on the untargeted DNA strand [38]. Thus, the CRISPR system consists of two components (a Cas9 endonuclease and a guide RNA) as a ribonucleoprotein. Experimentally, the guide RNA can be designed using molecular biology tools in the laboratory to direct Cas9 to a specific DNA sequence for cleavage at virtually any genomic locus. The milestones for the use of CRISPR/Cas9 in producing gene-edited swine are shown in Table 2.

Advantages and applications

Traditional livestock breeding is beset with such problems as long breeding cycles and limitations of genetic resources. In contrast, genome editing tools can provide more precise, more specific, more predictable and more rapid solutions to solving these problems at relatively affordable costs [38]. Thus, besides knocking out gene function, CRISPR can be employed to delete large DNA fragments from the genome of an animal. Furthermore, a gene editing technique requires fewer steps and has a higher efficiency than the previous methods of animal transgenesis. For example, studies with livestock zygotes have shown a 30% editing frequency with ZFN, TALEN and CRISPR/ Cas9 techniques [19, 72,73,74,75,76,77]. Compared to other gene silencing techniques such as RNAi and antisense RNA, CRISPR/Cas9 offers a higher efficiency, an ability to cleave methylated loci, greater ease of design, and greater flexibility [68]. It should be borne in mind that knockout of a gene provides a cleaner phenotype than its knockdown and that production of knockout pigs does not necessarily require application of a genome editing system. Several laboratories have reported success with producing gene-edited pigs, which can potentially serve as organ donors, disease models, bioreactors, inactivation of porcine endogenous retrovirus in pigs, or founder animals of genetic lines with enhanced productivity (e.g., muscle growth) or disease resistance traits [59,60,61,62,63,64]. Thus, gene editing increases successes in single-gene and multi-allelic modifications of the livestock genome, as well as in site-specific introductions of foreign genes during embryogenesis.

There are many examples for the genome editing-based production of transgenic pigs with important production and disease-resistance traits, including nutrient utilization and meat production as well as resistance to viral infections and metabolic disorders (Table 3). First, disruption of the myostatin (a negative regulator of myogenesis) gene using TALEN as an editor successfully created myostatin-knockout pigs, which exhibited a double-muscled phenotype, greater body weight, greater longissimus muscle mass, and a 100% increase in the number of muscle fibers than wild-type pigs [78]. Second, utilizing the CRISPER/Cas9 technology, Zheng et al. [79] produced pigs with a functional uncoupling protein 1 (UCP1). UCP1 is expressed in the brown adipose tissue of many animal species and is responsible for nonshivering thermogenesis, thereby playing a crucial role in protecting against cold and regulating energy homeostasis. However, modern pigs lack functional UCP1 genes and are therefore susceptible to cold stress, resulting in a high rate of neonatal mortality, and also spontaneous accumulation of a large amount of white adipose tissue in the body, leading to reduced production performance [3]. Of note, insertion of the mouse adiponectin-UCP1 gene into the porcine endogenous UCP1 locus via the CRISPR/Cas9 as an editor can generate UCP1-knockin pigs that exhibit an improved ability to maintain body temperature, a decreased white fat mass, and an increased lean carcass yield [79]. Third, CRISPR/Cas9 gene targeting and SCNT technologies have been used to create pigs without the CD163 gene that encodes a cellular receptor for the porcine reproductive and respiratory syndrome virus-1 (PRRSV-1, also referred to as “blue ear disease” virus) [59]. Whitworth et al. [60] reported that pigs with the CD163 knock-out were fully resistant to the PRRSV-1 (European strain) and PRRSV-2 (North American strain). Similar results were observed by Burkard et al. [63] against both PRRSV-1 and PRRSV-2, and by Yang et al. [64] against a highly pathogenic PRRSV strain (belonging to the North American strain) isolated in South China. Interestingly, Wells et al. [61] found that genetically modified pigs, which were produced through the replacement of porcine CD163 scavenger receptor cysteine-rich domain 5 with a CD163-like homolog, were resistant to PRRSV-1 but not to PRRSV-2. Males and females can be used as breeding stocks to produce generations of PRRSV-resistant offspring.

Dezavantaje

Although the ZFN method provided the first breakthrough in site-specific gene editing, it has some limitations, such as off-target cutting of the DNA, cytotoxicity, expensive, time-consuming, low efficiency (thus only one genomic edit at a time), and technical challenges to prepare effective ZFN tools [38]. Compared with the ZFN editor, the TALEN technique is more flexible in genetic engineering because its DNA-binding domain can target a wider range of DNA sequences. Although the TALEN editor is easier to design than the ZFN, the TALEN method is expensive and technically difficult when the goal is to simultaneously make multiple edits to the genome [68]. In addition, delivering the gene-editing Cas9 directly to embryos by microinjection remains a challenging process, and microinjection itself may damage the embryos. Compared to the ZFN and TALEN, CRISPR/Cas9 is known to have a higher frequency of off-target effects [80]. Another major obstacle to the use of the CRISPR/Cas9 technology for generating gene-edited animals is the problem of mosaicism (the presence of more than one genotype in one individual) that is common in founder animals [68]. Furthermore, for all currently available gene-editing methods, the rates of prenatal mortality in gene-edited fetuses are much greater than those for control fetuses. To date, the efficiency of gene editing in livestock, including swine, remains suboptimal. The procedures for gene editing should be easier and cheaper, so that more producers can utilize this innovative technique on their own farms for improving animal breeding.


MULȚUMIRI

This work was supported by the Slovenian Research Agency under grant agreement no.(Z2-7257) and was in part carried out at the Faculty of Health Sciences, University of Primorska, Izola, Slovenia. I kindly thank Maria Pilar Garcillán-Barcia, Fernando de la Cruz (UNICAN, Spain), and Joshua Ramsey (Curtin Univ., Australia) for sharing and discussing data, Filip Buric (Chalmers Univ. of Tech., Sweden) for commenting on the manuscript, and Tomaz Pisanski (UP-FAMNIT, Slovenia) and Ales Lapanje (IJS, Slovenia) for helpful discussions in their respective fields of research.


Priveste filmarea: Plasmids. Cloning vectors: Plasmids. Why do we use plasmids in RDT? features of a plasmid (Ianuarie 2022).